AJCN North Carolina Research Campus
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ngom, P. T
Right arrow Articles by Aspinall, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ngom, P. T
Right arrow Articles by Aspinall, R.
Agricola
Right arrow Articles by Ngom, P. T
Right arrow Articles by Aspinall, R.
American Journal of Clinical Nutrition, Vol. 80, No. 3, 722-728, September 2004
© 2004 American Society for Clinical Nutrition


ORIGINAL RESEARCH COMMUNICATION

Improved thymic function in exclusively breastfed infants is associated with higher interleukin 7 concentrations in their mothers' breast milk1,2,3

Pa T Ngom, Andrew C Collinson, Jeffrey Pido-Lopez, Sian M Henson, Andrew M Prentice and Richard Aspinall

1 From the Department of Immunology, Imperial College London, Chelsea & Westminster Hospital, London (PTN, JPL, SMH, and RA); the Medical Research Council International Nutrition Group, London School of Hygiene and Tropical Medicine, London (PTN, ACC, and AMP); and the Medical Research Council Keneba, The Gambia (PTN, ACC, and AMP)

2 Supported by the Nestlé Foundation, the MRC International Nutrition Group, and the Islamic Development Bank.

3 Address reprint requests to R Aspinall, Department of Immunology, Faculty of Medicine, Imperial College London, Chelsea & Westminster Hospital, 369 Fulham Road, London SW10 9NH, United Kingdom. E-mail: r.aspinall{at}imperial.ac.uk.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Background: In rural Gambians, the season of birth strongly predicts adult mortality. Those born during the harvest season have longer life spans than do those born during the hungry season, and the deaths associated with infectious diseases suggest permanent early-life influences on immunity. Thymic measurements showed significantly smaller thymuses in infants born during the hungry season than in those born during the harvest season. The differences were greatest at 8 wk of age, a time when all infants were exclusively breastfed, which suggests the involvement of breast milk factors.

Objective: This study tested whether thymic size differences reflect thymic output and ascertained whether thymic output is associated with breast milk interleukin 7 (IL-7) concentrations.

Design: We studied thymic size and output in a prospective cohort of 138 Gambian infants born in either the hungry or the harvest season by measuring signal-joint T cell receptor–rearrangement excision circles (sjTRECs) at birth and at 8 wk of age. IL-7 concentrations in breast milk were measured by using an enzyme-linked immunosorbent assay.

Results: By age 8 wk, those born in the hungry season had significantly lower sjTREC counts than did those born in the harvest season (0.97 and 2.12 sjTRECs/100 T cells, respectively; P = 0.006). At 1 wk postpartum, the breast milk of mothers of infants born in the hungry season had significantly lower IL-7 than did that of mothers of infants born in the harvest season (79 and 100 pg/mL, respectively; P = 0.02). The findings were similar at 8 wk postpartum.

Conclusion: These data show a plausible pathway linking external seasonal insults to mothers with thymic development in their infants, which suggests possible implications for long-term programming of immunity.

Key Words: Breast milk • thymus • lymphocytes • immune programming • infection • nutritional deprivation • signal-joint T cell receptor–rearrangement excision circles • sjTRECs • interleukin 7


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We previously reported that adult mortality in rural Gambian villagers is strongly associated with the season in which they were born (1). This finding emerged from a Kaplan-Meier survival analysis of 1077 deaths in 3102 persons whose date of birth had been accurately recorded with the use of a continuous demographic recording system initiated in 1949. Analysis of hungry-season births versus harvest-season births revealed hazard ratios of 3.7 (P = 0.0001) for death at age > 15 y and of 10.3 (P = 0.0001) for death at age > 25 y (1, 2). Most of the adult deaths were due to infectious diseases, which leads to the hypothesis that early-life events that are correlated with season of birth permanently program adult immunity. The nature of these early exposures remains to be defined, but it could include fetal growth retardation (3), infection in the mother during pregnancy (eg, malaria; 4), exposure to environmental toxins (eg, aflatoxins; 5), and early postnatal nutritional or infectious insults.

Early nutritional influences represent strong candidates as factors regulating thymic function and immunity because the hungry season is a period of intense farm work that coincides with food shortages as the previous year's harvest runs out (6). These factors cause a negative energy balance that includes the mobilization of up to 50% of the body fat stores of pregnant and lactating women (7). Intrauterine growth retardation is common at this time of year, when there is a higher prevalence of low-birth-weight infants than during the harvest season (6). The thymus is a likely target for putative programming of immunity because it is both highly sensitive to undernutrition and fundamental to the development of the immune system (8, 9). We used ultrasound to assess the seasonal patterns of thymic growth at 1, 8, 24, and 52 wk of age in a birth cohort of 138 infants recruited prospectively over a 14-mo period. Thymic index was shown to be affected both by the season of birth and by the season in which measurements were taken (10). The differences between thymic index in harvest- and hungry season infants were greatest at 8 wk of age (Table 1Go), a time when the infants were exclusively breastfed, when clinically evident infections were relatively absent, and when low-birth-weight infants' growth had caught up to international standards.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Thymic size by season of measurement1

 
The purposes of the current study were twofold: first, to assess whether the differences in thymic size in this cohort were also reflected in changes in thymocyte output assessed by measuring signal-joint T cell receptor–rearrangement excision circles (sjTRECs) and, second, to test whether postnatal thymic growth might relate to the concentration of IL-7 in the mother's breast milk. The latter investigation was suggested by both the fact that immunoprotective factors in the milk of Gambian mothers were previously shown to vary substantially by season (11) and the observation that breastfed infants have larger thymuses than do formula-fed infants (12). IL-7 is known to improve thymic output in animal models (1315) but has not previously been studied in human milk.


    SUBJECTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Subjects
The 138 mother-infant pairs enrolled in this study were recruited over a 14-mo period from rural subsistence-farming communities in the West Kiang region of The Gambia, a country in West Africa. Detailed anthropometric measurements of the infants were performed at birth and at 4-wk intervals throughout infancy. Active surveillance for infections was carried out fortnightly, and a full clinical examination was performed at monthly intervals. Appropriate treatment for any infection was given. The full Gambian Government program of immunization was administered. Blood was drawn at birth and at 8, 16, and 52 wk of age for analysis of nutritional status, aflatoxin exposure (assessed by plasma aflatoxin adduct concentrations; 5), lymphocyte populations, and vaccine responses. The white blood cell (WBC) count (cells/µL) was estimated by using the Coulter counter (Beckman Coulter, United Kingdom), and the percentage of lymphocytes was determined by using microscopy. Lymphocyte subsets including CD3+ cells were evaluated by flow cytometry using the FACSCalibur flow cytometer (Becton Dickinson UK Ltd, Oxford, United Kingdom). In the field, 100 µL of EDTA-containing whole blood was incubated for 10 min at room temperature in the dark with 10 µL anti-CD3 (or other lymphocyte subsets analyzed) monoclonal antibody (Cyto-stat; Beckman Coulter SA, Nyon, Switzerland) conjugated to PC5 fluorescent dye. The red blood cells were then lysed, and the WBCs were fixed and stabilized with the use of the QPrep machine (Beckman Coulter) with accompanying reagents. The stained samples were stored at 4°C for a few days and then packed in cold boxes and transported by road to the Medical Research Council laboratories in Fajara, The Gambia, where they were spun by centrifugation at 800 rpm for 5 min (Mistral 30001; Henderson Biomed Ltd, Beckenham, United Kingdom). Next, the supernatant fluids were decanted off; this step was followed by washing in 1 mL phosphate-buffered saline (PBS), and then the cell pellet was resuspended in 300 µL PBS-1% paraformaldehyde. The samples were then acquired and analyzed by flow cytometry, by gating around the lymphocyte population. CD45 staining was used to determine the purity of the lymphocyte population with data accepted for ≥95% purity. The number of CD3 cells/mL whole blood was calculated by multiplying the percentage of lymphocytes by the absolute WBC count/mL to obtain the absolute number of lymphocytes, which was then multiplied by the number of CD3+ cells as a percentage of the total lymphocyte count in the sample (CD3%) to give the number of CD3 cells/mL whole blood (% lymphocytes x WBCs/mL x CD3% = CD3/mL). CD3% was validated by ensuring that the sum of CD4% and CD8% was approximately equal to CD3% and that CD16/56%, CD19%, and CD3% totaled 100 ± 10% (ie, the T cells, B cells, and natural killer cells equal the total lymphocytes).

Thymic size was assessed at 1, 8, 24, and 52 wk by using sonography as described in detail elsewhere (10). Briefly, infants were scanned in the supine position; a minimum of 3 measurements were taken, and the means of 3 good-quality measures were used. The transverse diameter and sagittal area of the largest lobe were multiplied to obtain a volume-related thymic index. The work described here was based on 99 (of the original 138) mother-infant pairs who were selected because they had, along with matching milk samples, sufficient residual cell samples to allow the sjTREC analysis. The breast milk sampling was standardized as much as possible by manual expression of milk from both breasts into separate containers between 0600 and 0700. This would have been the first feed of the day for most mothers. Ethical approval was granted by the Medical Research Council and Gambian Government Joint Ethical Committee (Reference number SCC 734/705).

Definitions
In line with the original mortality analysis (1) and the ultrasound study of thymic size (10), the harvest season was defined as spanning January through June (a period of complete absence of rain), and the hungry season was defined as spanning July through December (a period including the rainy season). As well as being a time of relative food shortage, which is especially acute in August and September, the hungry season is a time of greatly increased infectious load (16).

Breast milk enzyme-linked immunosorbent assay
Breast milk samples (2–5 mL) were collected in the early morning by maternal manual expression. Samples were collected at 1 and 8 wk postpartum and frozen at –70°C. An enzyme-linked immunosorbent assay was developed by using commercially available reagents to measure IL-7 levels in breast milk. Briefly, 96-well Maxisorp plates (VWR International, Poole, United Kingdom) were coated with 100 µL of 5 µg monoclonal mouse anti-human IL-7 antibody (R&D Systems Europe Ltd, Abingdon, United Kingdom)/mL in PBS (Sigma-Aldrich, Gillingham, United Kingdom) and incubated overnight at 4°C. The plates were washed and blocked with PBS/1% bovine serum albumin (BSA). Doubling dilutions were prepared of recombinant human IL-7 in PBS/0.1% BSA to give a standard range from 7.8 to 1000 pg/mL, and 100 µL was added per well. Each breast milk sample was processed in triplicate at 100 µL/well, and plates were incubated at room temperature for 2 h and washed in PBS with 0.5% Tween 20 before the addition to the wells of 100 µL biotinylated goat anti-human IL-7 immunoglobulin G antibody/mL (R&D Systems Europe Ltd) in TBS/0.1% BSA. The plate was incubated at room temperature for 2 h and washed; next, streptavidin-horseradish peroxidase conjugate (R&D Systems Europe Ltd) diluted 1:200 in PBS/0.1% BSA was added. After a 20-min incubation at room temperature, the plates were washed, substrate was added to each well for 30 min, color development was stopped by the addition of 50 µL of 1 mmol H2SO4/L, and the plates were read at 450 nm. Initial analysis showed that IL-7 was stable when frozen and remained so after 2 repeated freeze-thaw treatments, with a sharp decline in detectable concentrations thereafter. The results presented here were obtained from ≤2 freeze-thaw treatments.

Measurement of sjTRECs
sjTRECs are generated when the T cell receptor (TCR) {delta} locus gene segments (VDJC) are removed from within the TCR{alpha} locus during rearrangement of TCR{alpha} gene segments (VJC), a phenomenon observed in 70% of {alpha}ß T cells (17). DNA was isolated from the frozen whole-blood samples by using the QIAamp DNA Mini Kit (QIAGEN, Crawley, United Kingdom), according to the manufacturer's instructions. The sjTREC concentrations were analyzed according to a previously described method (17) by using real-time polymerase chain reaction (PCR) on a light cycler (Roche Diagnostics, Lewes, United Kingdom). sjTRECs were measured by Hot-start real-time PCR in the light cycler with the use of primers GCCACATCCCTTTCAACCATGCTGAC (forward) and TTGCTCCGTGGTCTGTGCTGGCATC (reverse). A standard was prepared by using serial dilutions of a known number of copies of a fragment of the sjTREC gene sequence and included in each light cycler run to generate a standard curve. Using 0.2-mL PCR tubes on ice, we made a master mix of 2 µL SYBRGreen (Roche Diagnostics), which binds double-stranded DNA, and 0.16 µL of anti-Taq antibody (Sigma Aldrich) and incubated the mix for 10 min at room temperature; then 3.2 µL (4 mmol/L) MgCl2, 0.2 µL (0.4 µmol/L) of each of the primer pairs and 10.64 µL sterile water were combined, and 18 µL of this mixture was pipetted into all tubes followed by 2 µL of standards, samples, or a negative control in corresponding tubes to obtain a 20-µL reaction volume. Real-time PCR was then performed in glass capillaries under the following conditions: 1 cycle of 95°C for 1 s; 5 preamplification cycles of 95°C for 5 s, 60°C for 10 s, 72°C for 12 s, and 83°C for 5 s; and 40–60 cycles of second amplification and fluorescence measurement of 95°C for 1 s, 60°C for 5 s, 72°C for 12 s, and 83°C for 5 s, during which fluorescence measurements were taken. The number of copies of sjTRECs in the original samples was automatically determined by reading off the standard curves generated.

Statistical analysis
Data were tested for normal distribution, and nonnormally distributed data were log transformed to achieve normalization. Student's t test was used to compare means, and the 95% CI was calculated. P values of < 0.05 were considered statistically significant. For the breast milk IL-7 enzyme-linked immunosorbent and sjTREC assays, we analyzed each sample in triplicate and observed low CVs; outliers were easily identified and excluded from the analysis.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Variation in sjTREC concentrations by season of birth
To ascertain whether the observed difference in thymic size (Table 1Go) would be reflected by similar differences in sjTREC concentrations, we analyzed blood drawn from infants at age 8 wk. The results revealed that, despite considerable monthly variations (Figure 1Go A), the harvest-season infants had significantly higher geometric mean (95% CI) sjTREC concentrations than did the hungry-season infants for the aggregated monthly values of the 2 seasons (Table 2Go). Similar results were seen for absolute sjTREC counts expressed per milliliter of whole blood (Figure 1BGo, Table 2Go). Further analysis of the monthly pattern of variation in measurements at age 8 wk revealed sustained higher monthly sjTREC concentrations during the harvest season (January–June) but a declining trend during the hungry season (July–December). The uncharacteristically low geometric mean of sjTRECs/100 T cells during the harvest season, seen in May, could have been due to the small sample size (n = 2).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 1. The distribution of geometric mean signal-joint T cell receptor–rearrangement excision circle (sjTREC) concentrations in T cells and whole blood by month of birth in blood samples from 53 harvest-season (January–June) infants and 46 hungry-season (July–December) infants at week 8. Aggregate seasonal geometric mean of sjTREC counts for the harvest and hungry seasons are shown as square points. Error bars represent 95% CIs. Note that there were only 2 subjects in May and that the DNA concentrations for these subjects were the lowest, at 50 µg/mL each. A notable steady decline in sjTREC concentrations can be seen from July through November (hungry season). Aggregate seasonal means with different letters are significantly different: T cells, P = 0.006 (Student's t test); whole blood, P = 0.035.

 

View this table:
[in this window]
[in a new window]
 
TABLE 2 Lymphocyte and signal-joint T cell receptor–rearrangement excision circle (sjTREC) statistics at age 8 wk by season of birth1

 
To explore the possibility that the observed differences in sjTREC concentrations at age 8 wk may already have existed at birth, we analyzed cord blood sjTRECs from the harvest and hungry seasons. T cell counts were considered unreliable for the cord blood samples analyzed for sjTRECs, and therefore we expressed sjTRECs/µg DNA. Cord blood red blood cells are known to be particularly difficult to lyse (18), and some cord blood–extracted DNA may contain high concentrations of components that are inhibitory to PCR (19); as a result, it was not possible to obtain adequately pure amounts of DNA from all the samples for the cord blood sjTREC analysis. The results of the cord blood sjTREC analysis showed that there was no significant seasonal difference in cord blood sjTRECs/µg total DNA (data not shown).

Variation in lymphocyte counts and T cell numbers by season of birth
To assess possible relations between T cell numbers and sjTRECs, the total lymphocyte and T cell counts were analyzed for all 99 infants included in the sjTREC analysis at age 8 wk. There was some variation in the T cell counts obtained during the harvest- and hungry-season months (Figure 2Go), but this difference was not statistically significant for the percentage of CD3+ cells (Table 2Go). There was also no significant difference in absolute numbers of CD3+ cells (Table 2Go). Total lymphocyte count was, however, significantly higher in the hungry season than in the harvest season (Table 2Go).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 2. Distribution of absolute CD3+ cells in whole blood by month of birth in samples from week 8. The lower, middle, and upper lines in each box represent the 25th, 50th, and 75th percentiles (also known as the lower, median, and upper quartiles), respectively. The lower and upper horizontal lines represent the lowest and highest values for each month. The mean is also indicated as +. Student's t test was used to compare means. Differences were not significant.

 
Variation in mother's breast milk IL-7 by season of infant's birth
Frozen whole breast milk from samples taken in week 1 from the mothers of 59 harvest-season and 64 hungry-season infants and in week 8 from the mothers of 75 harvest-season and 52 hungry-season infants were analyzed for IL-7 concentrations. Despite considerable monthly variation, breast milk from the mothers of harvest-season infants contained significantly (P = 0.02) higher IL-7 concentrations than did that of the mothers of hungry-season infants at 1 wk postpartum (Figure 3Go). At 8 wk postpartum, however, the IL-7 concentrations were still higher in the mothers of harvest-season infants than in the mothers of hungry-season infants, but the difference was not significant (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 3. Geometric mean interleukin 7 (IL-7) concentrations in breast milk by month of birth in samples from the mothers of 53 harvest-season (January–June) infants and 46 hungry-season (July–December) infants at week 8. Error bars represent 95% CIs. The aggregate seasonal geometric mean breast milk IL-7 concentrations are shown as square points. The geometric means for the harvest and hungry seasons were 100 (95% CI: 83.50, 119.80 pg/mL) and 79 pg/mL (95% CI: 69.40, 90.90 pg/mL), respectively. Aggregate seasonal means with different letters are significantly different (P = 0.02; Student's t test).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Our previous observation—that early-life factors, in correlation with the season of birth, have a profound impact on mortality that is due to infectious diseases in young adulthood—requires a biological explanation. The wide variety of seasonal exposures in the community studied, combined with the complexity of the human immune system, means that no single study will be able to identify the causal mechanism or mechanisms. For this reason, we have initiated several studies in different age groups and using different investigative tools (especially vaccine challenges) in this and other seasonally affected populations. Cell-mediated immunity is a likely candidate as the explanation for the biological mechanisms involved in the effects of season of birth on mortality, and the study of early thymocyte development makes a logical target in view of the known sensitivity of the thymus to nutritional, infectious, and stress-related insults (8, 20).

There could be several explanations for the observed increase in thymic size during the harvest season in infants in this community. For instance, it could have been due to increased thymopoiesis, which is shown to result in increased numbers of CD4+ CD8+ (double-positive) thymocytes in the thymic cortex during reversal of starvation-induced thymic involution in ob/ob mice (21), to increased numbers of fat cells (22), or to the possible entry of lymphocytes from the periphery (23). The current finding that the increased thymic size was also associated with increased sjTREC concentrations suggests an association between an improved thymic output and harvest-season births. Although there are other possible explanations for the seasonal differences in sjTREC concentrations, they could plausibly be linked to maternal nutritional status. Improved maternal nutrition during the harvest season may improve the infants' thymic activity through an increase in a factor or factors in breast milk that enhance the generation of thymocytes—hence, the observed increase in sjTREC concentrations. We have not used purified peripheral blood mononuclear cells for our sjTREC assay because only frozen whole blood was available, but the use of whole blood was unlikely to introduce errors to the assay because we took care to extract and purify DNA from whole blood by using the QIAamp blood purification kit, which is reliable for the generation of pure PCR-amplifiable DNA from such samples. Because of their restriction to the {alpha}ß T cell lineage, it is not necessary to purify CD3+ T cells before their analysis (24). The calculation of sjTREC concentrations per T cell is considered to be an appropriate indicator of changes in thymic function, although its use as a marker for absolute thymic function is controversial, partly because of the influence that T cell proliferation (usually in disease situations) may have on sjTREC concentrations independent of thymic output (25). During an infection, activation of T cells and their expansion to produce effector cells lead to a dilution of the episomal sjTRECs that do not divide with the cell. Therefore, the extent of T cell proliferation must be taken into account in interpreting sjTRECs as a marker of thymic function. The CD3+ cell count does not support any significant dilution of sjTRECs in our analysis, and other peripheral WBCs, such as monocytes, granulocytes, and B cells, are negative for sjTRECs because they are not known to express the TCR; therefore their proliferation is irrelevant to the concentration of sjTRECs per T cell. The analysis of the number of sjTRECs/mL whole blood, which reflects the absolute sjTREC numbers, has also confirmed significantly greater average sjTREC content during the harvest season. Nonetheless, the characteristic rise in infections during the hungry season increases the risk of productive infection and the related possibility of increased T cell proliferation that would result in sjTREC dilution. Although these possibilities may exist for many persons in the study community, they were considered unlikely for those at the specific age of 8 wk, when exclusive breastfeeding was practiced, the infants had good weight and diminished prevalence of infections, and they appeared healthy. Taken together, our data imply that the higher sjTREC counts of the harvest season were a likely reflection of the greater number of recent thymic emigrants in the harvest-season infants than in the hungry-season infants.

The crude division of the year into the harvest and hungry seasons was limited by sample size considerations, and thus inevitable overlaps may have diluted some of the statistical power in the correlations of the immunologic values measured with thymic size. A closer look at the months of September, October, and November, which fall within or immediately after the peak of the rainy season with its high prevalence of malaria and other infections, found that they coincided with the observed increases in lymphocyte counts. The slightly higher CD3+ T cell count of these months (Figure 2Go) could be attributed to the relative increases in proliferation of these cells that is driven by the antigenic load from the endemicity of various infections at this time (16). The higher total lymphocyte counts at this time may be due to expansions in the B lymphocyte population that are often associated with malaria infection and associated diseases (26, 27). This period is also the height of the hungry season, during which more extreme nutritional deprivation is expected to further suppress the thymus and lead to additional lowering of thymic output. That is evidenced by the occurrence of the lowest sjTREC concentrations during these months, which is consistent with findings that nutritional rehabilitation of malnourished children resulted in greater thymic size and improved immunologic function (28) and that the reverse was true during dietary restriction (29).

Although maternal immune factors and cytokines may affect the fetus via the intrauterine route (30), detection in the harvest season of higher concentrations of breast milk IL-7 at 1 wk postpartum and of evidence of improved thymic activity in exclusively breastfed infants at age 8 wk suggested that the composition of the food originating from the mother and possibly reflecting her own nutritional status may be linked to the enhancement of the infant's developing immune system. IL-7 is essential for the proliferation and survival of precursor T cells, which show elevated sensitivity to IL-7 during the earliest stages of thymocyte development (31, 32). Once these precursors, which are committed to the T cell lineage, mature and exit the thymus as recent thymic emigrants, IL-7 also induces their proliferation and survival, which maintain the T cell repertoire (33). It was shown recently that homeostatic control of the memory CD4+ T cell pool is also regulated by IL-7 and does not require IL-15, unlike that of memory CD8+ T cells (34). These findings emphasize the importance of IL-7 in all stages of T cell development, with particular relevance to the maturing immune system in early life. Although breast milk is known to contain a number of cytokines and growth factors (35), this report is the first that it contains IL-7 and that there are variations in the IL-7 concentrations. The presence of IL-7 in breast milk was not necessarily predictable because IL-7 was previously reported to be produced by stromal cells of the thymus (36), bone marrow (37), and dendritic cells (38). However, active secretion of other cytokines, including IL-18 and transforming growth factor ß, in breast milk has been reported (35, 39, 40), and it has been suggested that cytokines made elsewhere in the body may home to the mammary gland (41).

A role for breast milk in the improvement of thymic function has been implicated in findings that breastfeeding is associated with greater thymic size in infancy than is feeding with formula milk (42). Although transfer of the IL-7 from the breast milk across the gut and then onward to the infant's thymus may seem difficult, it has been shown that breast milk fat globules contain proteins known to resist the infant's gut digestive enzymes and hence to remain functionally active (43). Furthermore, soluble receptors of cytokines known to bind their ligands may then act as carrier proteins, which results in more stable receptor-cytokine complexes with an extended half-life (44). Preliminary analysis of our results indicates that breast milk IL-7R{alpha} concentrations followed a pattern similar to that of the cytokine, which may further favor successful transfer of viable IL-7 to the infant via breast milk. Receptors for cytokines are known to exist in the gut (45), and cryptopatches, which are part of the murine intestinal immune compartment, express the IL-7 receptor (46); this suggests that IL-7 receptors may also exist in the human gut and that breast milk IL-7 may cross the gut epithelium into the circulation via these receptors. Immune compartments such as Peyer's patches (47, 48) and M cells (4850) are known transfer routes for gut proteins. The presence in the thymus of IL-7 receptors and the high density of cells with increased sensitivity to IL-7 (51) make it possible that any IL-7 crossing into the infant's circulation will affect these thymocytes.

Although by no means conclusive, this study suggests a possible mechanistic route through which external factors (including maternal nutritional restriction) during the hungry season may affect IL-7 concentrations (or related trophic factors) in breast milk, which in turn may influence thymic size and thymopoiesis in early infancy. We showed elsewhere that infants have a characteristic thymic size that tracks through infancy, even after adjustment for body weight (10). It is plausible that such early variations may represent a permanent programming of thymic development, which in turn could influence adult T cell function through differences in T cell pool size, repertoire, or both. The accumulated effects of these events is predicted to precipitate premature immune senescence by inducing accelerated T cell division with age as a response to the disproportionate pressures on an immune system that is fundamentally inhibited by early-life events. We are currently investigating these possibilities in a cohort of older subjects from the same community.


    ACKNOWLEDGMENTS
 
We are grateful to the villagers in the community, in particular the mothers and infants who participated in this study, and to the field, laboratory, clinical, administrative, and other support staff of the MRC laboratories in The Gambia, especially the nutrition group based in Keneba.

PTN, JP-L, and SMH carried out the assays; ACC organized the fieldwork and sample collection; and AMP and RA designed the study. None of the authors had any conflict of interest with the study.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Moore SE, Cole TJ, Poskitt EM, et al. Season of birth predicts mortality in rural Gambia. Nature 1997;388:434(letter).[Medline]
  2. Moore SE, Cole TJ, Collinson AC, Poskitt EM, McGregor IA, Prentice AM. Prenatal or early postnatal events predict infectious deaths in young adulthood in rural Africa. Int J Epidemiol 1999;28:1088–95.[Abstract/Free Full Text]
  3. Chandra RK. Nutrition and the immune system from birth to old age. Eur J Clin Nutr 2002;56(suppl):S73–6.
  4. Greenwood AM, Armstrong JR, Byass P, Snow RW, Greenwood BM. Malaria chemoprophylaxis, birth weight and child survival. Trans R Soc Trop Med Hyg 1992;86:483–5.[Medline]
  5. Turner PC, Moore SE, Hall AJ, Prentice AM, Wild CP. Modification of immune function through exposure to dietary aflatoxin in Gambian children. Environ Health Perspect 2003;111:217–20.[Medline]
  6. Prentice AM, Whitehead RG, Watkinson M, Lamb WH, Cole TJ. Prenatal dietary supplementation of African women and birth-weight. Lancet 1983;1:489–92.[Medline]
  7. Paul AA, Muller EM, Whitehead RG. Seasonal variations in energy intake, body-weight and skinfold thickness in pregnant and lactating women in rural Gambia. Proc Nutr Soc 1979;38:28A.[Medline]
  8. Prentice AM. The thymus: a barometer of malnutrition. Br J Nutr 1999;81:345–7.[Medline]
  9. Savino W. The thymus gland is a target in malnutrition. Eur J Clin Nutr 2002;56(suppl):S46–9.
  10. Collinson AC, Moore SE, Cole TJ, Prentice AM. Birth season and environmental influences on patterns of thymic growth in rural Gambian infants. Acta Paediatr 2003;92:1014–20.[Medline]
  11. Prentice A, Watkinson M, Prentice AM, Cole TJ, Whitehead RG. Breast-milk antimicrobial factors of rural Gambian mothers. II. Influence of season and prevalence of infection. Acta Paediatr Scand 1984;73:803–9.[Medline]
  12. Hasselbalch H, Jeppesen DL, Engelmann MD, Michaelsen KF, Nielsen MB. Decreased thymus size in formula-fed infants compared with breastfed infants. Acta Paediatr 1996;85:1029–32.[Medline]
  13. Fry TJ, Christensen BL, Komschlies KL, Gress RE, Mackall CL. Interleukin-7 restores immunity in athymic T-cell-depleted hosts. Blood 2001;97:1525–33.[Abstract/Free Full Text]
  14. Fry TJ, Mackall CL. Interleukin-7: from bench to clinic. Blood 2002;99:3892–904.[Free Full Text]
  15. Pido-Lopez J, Imami N, Andrew D, Aspinall R. Molecular quantitation of thymic output in mice and the effect of IL-7. Eur J Immunol 2002;32:2827–36.[Medline]
  16. Mulholland EK, Ogunlesi OO, Adegbola RA, et al. Etiology of serious infections in young Gambian infants. Pediatr Infect Dis J 1999;18:S35–41.[Medline]
  17. Douek DC, McFarland RD, Keiser PH, et al. Changes in thymic function with age and during the treatment of HIV infection. Nature 1998;396:690–5.[Medline]
  18. Serrani RE, Alonso D, Corchs JL. States of stability/lysis in human fetal and adults red blood cells. Arch Int Physiol Biochim 1989;97:309–16.[Medline]
  19. Wilson IG. Inhibition and facilitation of nucleic acid amplification. Appl Environ Microbiol 1997;63:3741–51.[Medline]
  20. Savino W, de Moraes MC, Barbosa SD, Da Fonseca EC, De Almeida VC, Hontebeyrie-Joscowicz M. Is the thymus a target organ in infectious diseases? Mem Inst Oswaldo Cruz 1992;87(suppl):73–8.
  21. Howard JK, Lord GM, Matarese G, et al. Leptin protects mice from starvation-induced lymphoid atrophy and increases thymic cellularity in ob/ob mice. J Clin Invest 1999;104:1051–9.[Medline]
  22. Korobkin M, Giordano TJ, Brodeur FJ, et al. Adrenal adenomas: relationship between histologic lipid and CT and MR findings. Radiology 1996;200:743–7.[Abstract/Free Full Text]
  23. Haynes BF, Heinly CS. Early human T cell development: analysis of the human thymus at the time of initial entry of hematopoietic stem cells into the fetal thymic microenvironment. J Exp Med 1995;181:1445–8.[Abstract/Free Full Text]
  24. Douek DC, Vescio RA, Betts MR, et al. Assessment of thymic output in adults after haematopoietic stem-cell transplantation and prediction of T-cell reconstitution. Lancet 2000;355:1875–81.[Medline]
  25. Hazenberg MD, Otto SA, Cohen Stuart JW, et al. Increased cell division but not thymic dysfunction rapidly affects the T-cell receptor excision circle content of the naive T cell population in HIV-1 infection. Nat Med 2000;6:1036–42.[Medline]
  26. Osmond DG, Priddle S, Rico-Vargas S. Proliferation of B cell precursors in bone marrow of pristane-conditioned and malaria-infected mice: implications for B cell oncogenesis. Curr Top Microbiol Immunol 1990;166:149–57.[Medline]
  27. Morrow RH Jr. Epidemiological evidence for the role of falciparum malaria in the pathogenesis of Burkitt's lymphoma. IARC Sci Publ 1985;177–86.
  28. Chevalier P, Sevilla R, Zalles L, et al. [Immuno-nutritional recovery of children with severe malnutrition]. Sante 1996;6:201–8(in French).[Medline]
  29. Gartner A, Castellon WT, Gallon G, Simondon F. Total dietary restriction and thymus, spleen, and phenotype and function of splenocytes in growing mice. Nutrition 1992;8:258–65.[Medline]
  30. Letterio JJ, Geiser AG, Kulkarni AB, Roche NS, Sporn MB, Roberts AB. Maternal rescue of transforming growth factor-beta 1 null mice. Science 1994;264:1936–8.[Abstract/Free Full Text]
  31. Morrissey PJ, McKenna H, Widmer MB, et al. Steel factor (c-kit ligand) stimulates the in vitro growth of immature CD3-/CD4-/CD8- thymocytes: synergy with IL-7. Cell Immunol 1994;157:118–31.[Medline]
  32. Suda T, Zlotnik A. IL-7 maintains the T cell precursor potential of CD3-CD4-CD8- thymocytes. J Immunol 1991;146:3068–73.[Abstract]
  33. Soares MV, Borthwick NJ, Maini MK, Janossy G, Salmon M, Akbar AN. IL-7-dependent extrathymic expansion of CD45RA+ T cells enables preservation of a naive repertoire. J Immunol 1998;161:5909–17.[Abstract/Free Full Text]
  34. Seddon B, Tomlinson P, Zamoyska R. Interleukin 7 and T cell receptor signals regulate homeostasis of CD4 memory cells. Nat Immunol 2003;4:680–6.[Medline]
  35. Takahata Y, Takada H, Nomura A, et al. Interleukin-18 in human milk. Pediatr Res 2001;50:268–72.[Medline]
  36. Tang J, Nuccie BL, Ritterman I, Liesveld JL, Abboud CN, Ryan DH. TGF-beta down-regulates stromal IL-7 secretion and inhibits proliferation of human B cell precursors. J Immunol 1997;159:117–25.[Abstract]
  37. Isgro A, Aiuti F, Mezzaroma I, et al. Interleukin 7 production by bone marrow-derived stromal cells in HIV-1-infected patients during highly active antiretroviral therapy. AIDS 2002;6:2231–2.
  38. Wesa AK, Galy A. Regulation of T cell cytokine production by dendritic cells generated in vitro from hematopoietic progenitor cells. Cell Immunol 2001;208:115–24.[Medline]
  39. Donnet-Hughes A, Duc N, Serrant P, Vidal K, Schiffrin EJ. Bioactive molecules in milk and their role in health and disease: the role of transforming growth factor-beta. Immunol Cell Biol 2000;78:74–9.[Medline]
  40. Goldman AS, Chheda S, Garofalo R, Schmalstieg FC. Cytokines in human milk: properties and potential effects upon the mammary gland and the neonate. J Mammary Gland Biol Neoplasia 1996;1:251–8.[Medline]
  41. Reinholz MM, Iturria SJ, Ingle JN, Roche PC. Differential gene expression of TGF-beta family members and osteopontin in breast tumor tissue: analysis by real-time quantitative PCR. Breast Cancer Res Treat 2002;74:255–69.[Medline]
  42. Hasselbalch H, Engelmann MD, Ersboll AK, Jeppesen DL, Fleischer-Michaelsen K. Breast-feeding influences thymic size in late infancy. Eur J Pediatr 1999;158:964–7.[Medline]
  43. Hamosh M, Peterson JA, Henderson TR, et al. Protective function of human milk: the milk fat globule. Semin Perinatol 1999;23:242–9.[Medline]
  44. Heaney ML, Golde DW. Soluble receptors in human disease. J Leukoc Biol 1998;64:135–46.[Abstract]
  45. Carlsen HS, Baekkevold ES, Johansen FE, Haraldsen G, Brandtzaeg P. B cell attracting chemokine 1 (CXCL13) and its receptor CXCR5 are expressed in normal and aberrant gut associated lymphoid tissue. Gut 2002;51:364–71.[Abstract/Free Full Text]
  46. Saito H, Kanamori Y, Takemori T, et al. Generation of intestinal T cells from progenitors residing in gut cryptopatches. Science 1998;280:275–8.[Abstract/Free Full Text]
  47. Murai M, Yoneyama H, Ezaki T, et al. Peyer's patch is the essential site in initiating murine acute and lethal graft-versus-host reaction. Nat Immunol 2003;4:154–60.[Medline]
  48. Mowat AM, Viney JL. The anatomical basis of intestinal immunity. Immunol Rev 1997;156:145–66.[Medline]
  49. Gebert A, Bartels H. Ultrastructure and protein transport of M cells in the rabbit cecal patch. Anat Rec 1995;241:487–95.[Medline]
  50. Kaiserlian D, Etchart N. Entry sites for oral vaccines and drugs: a role for M cells, enterocytes and dendritic cells? Semin Immunol 1999;11:217–24.[Medline]
  51. Miyaji C, Watanabe H, Osman Y, Kuwano Y, Abo T. A comparison of proliferative response to IL-7 and expression of IL-7 receptors in intermediate TCR cells of the liver, spleen, and thymus. Cell Immunol 199;169:159–65.
Received for publication October 1, 2003. Accepted for publication March 25, 2004.




This article has been cited by other articles:


Home page
Am. J. Clin. Nutr.Home page
R. Raqib, D. S Alam, P. Sarker, S. M. Ahmad, G. Ara, M. Yunus, S. E Moore, and G. Fuchs
Low birth weight is associated with altered immune function in rural Bangladeshi children: a birth cohort study
Am. J. Clinical Nutrition, March 1, 2007; 85(3): 845 - 852.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
H. Ghattas, D. L Wallace, J. A Solon, S. M Henson, Y. Zhang, P. T Ngom, R. Aspinall, G. Morgan, G. E Griffin, A. M Prentice, et al.
Long-term effects of perinatal nutrition on T lymphocyte kinetics in young Gambian men
Am. J. Clinical Nutrition, February 1, 2007; 85(2): 480 - 487.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Herndler-Brandstetter, S. Schwaiger, E. Veel, C. Fehrer, D. P. Cioca, G. Almanzar, M. Keller, G. Pfister, W. Parson, R. Wurzner, et al.
CD25-Expressing CD8+ T Cells Are Potent Memory Cells in Old Age
J. Immunol., August 1, 2005; 175(3): 1566 - 1574.
[Abstract] [Full Text] [PDF]


Home page
Arch. Dis. Child.Home page
A M Prentice and S E Moore
Early programming of adult diseases in resource poor countries
Arch. Dis. Child., April 1, 2005; 90(4): 429 - 432.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ngom, P. T
Right arrow Articles by Aspinall, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ngom, P. T
Right arrow Articles by Aspinall, R.
Agricola
Right arrow Articles by Ngom, P. T
Right arrow Articles by Aspinall, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS