|
|
||||||||
ORIGINAL RESEARCH COMMUNICATION |
1 From the Department of Immunology, Imperial College London, Chelsea & Westminster Hospital, London (PTN, JPL, SMH, and RA); the Medical Research Council International Nutrition Group, London School of Hygiene and Tropical Medicine, London (PTN, ACC, and AMP); and the Medical Research Council Keneba, The Gambia (PTN, ACC, and AMP)
2 Supported by the Nestlé Foundation, the MRC International Nutrition Group, and the Islamic Development Bank. 3 Address reprint requests to R Aspinall, Department of Immunology, Faculty of Medicine, Imperial College London, Chelsea & Westminster Hospital, 369 Fulham Road, London SW10 9NH, United Kingdom. E-mail: r.aspinall{at}imperial.ac.uk.
| ABSTRACT |
|---|
|
|
|---|
Objective: This study tested whether thymic size differences reflect thymic output and ascertained whether thymic output is associated with breast milk interleukin 7 (IL-7) concentrations.
Design: We studied thymic size and output in a prospective cohort of 138 Gambian infants born in either the hungry or the harvest season by measuring signal-joint T cell receptorrearrangement excision circles (sjTRECs) at birth and at 8 wk of age. IL-7 concentrations in breast milk were measured by using an enzyme-linked immunosorbent assay.
Results: By age 8 wk, those born in the hungry season had significantly lower sjTREC counts than did those born in the harvest season (0.97 and 2.12 sjTRECs/100 T cells, respectively; P = 0.006). At 1 wk postpartum, the breast milk of mothers of infants born in the hungry season had significantly lower IL-7 than did that of mothers of infants born in the harvest season (79 and 100 pg/mL, respectively; P = 0.02). The findings were similar at 8 wk postpartum.
Conclusion: These data show a plausible pathway linking external seasonal insults to mothers with thymic development in their infants, which suggests possible implications for long-term programming of immunity.
Key Words: Breast milk thymus lymphocytes immune programming infection nutritional deprivation signal-joint T cell receptorrearrangement excision circles sjTRECs interleukin 7
| INTRODUCTION |
|---|
|
|
|---|
Early nutritional influences represent strong candidates as factors regulating thymic function and immunity because the hungry season is a period of intense farm work that coincides with food shortages as the previous year's harvest runs out (6). These factors cause a negative energy balance that includes the mobilization of up to 50% of the body fat stores of pregnant and lactating women (7). Intrauterine growth retardation is common at this time of year, when there is a higher prevalence of low-birth-weight infants than during the harvest season (6). The thymus is a likely target for putative programming of immunity because it is both highly sensitive to undernutrition and fundamental to the development of the immune system (8, 9). We used ultrasound to assess the seasonal patterns of thymic growth at 1, 8, 24, and 52 wk of age in a birth cohort of 138 infants recruited prospectively over a 14-mo period. Thymic index was shown to be affected both by the season of birth and by the season in which measurements were taken (10). The differences between thymic index in harvest- and hungry season infants were greatest at 8 wk of age (Table 1
), a time when the infants were exclusively breastfed, when clinically evident infections were relatively absent, and when low-birth-weight infants' growth had caught up to international standards.
|
| SUBJECTS AND METHODS |
|---|
|
|
|---|
95% purity. The number of CD3 cells/mL whole blood was calculated by multiplying the percentage of lymphocytes by the absolute WBC count/mL to obtain the absolute number of lymphocytes, which was then multiplied by the number of CD3+ cells as a percentage of the total lymphocyte count in the sample (CD3%) to give the number of CD3 cells/mL whole blood (% lymphocytes x WBCs/mL x CD3% = CD3/mL). CD3% was validated by ensuring that the sum of CD4% and CD8% was approximately equal to CD3% and that CD16/56%, CD19%, and CD3% totaled 100 ± 10% (ie, the T cells, B cells, and natural killer cells equal the total lymphocytes). Thymic size was assessed at 1, 8, 24, and 52 wk by using sonography as described in detail elsewhere (10). Briefly, infants were scanned in the supine position; a minimum of 3 measurements were taken, and the means of 3 good-quality measures were used. The transverse diameter and sagittal area of the largest lobe were multiplied to obtain a volume-related thymic index. The work described here was based on 99 (of the original 138) mother-infant pairs who were selected because they had, along with matching milk samples, sufficient residual cell samples to allow the sjTREC analysis. The breast milk sampling was standardized as much as possible by manual expression of milk from both breasts into separate containers between 0600 and 0700. This would have been the first feed of the day for most mothers. Ethical approval was granted by the Medical Research Council and Gambian Government Joint Ethical Committee (Reference number SCC 734/705).
Definitions
In line with the original mortality analysis (1) and the ultrasound study of thymic size (10), the harvest season was defined as spanning January through June (a period of complete absence of rain), and the hungry season was defined as spanning July through December (a period including the rainy season). As well as being a time of relative food shortage, which is especially acute in August and September, the hungry season is a time of greatly increased infectious load (16).
Breast milk enzyme-linked immunosorbent assay
Breast milk samples (25 mL) were collected in the early morning by maternal manual expression. Samples were collected at 1 and 8 wk postpartum and frozen at 70°C. An enzyme-linked immunosorbent assay was developed by using commercially available reagents to measure IL-7 levels in breast milk. Briefly, 96-well Maxisorp plates (VWR International, Poole, United Kingdom) were coated with 100 µL of 5 µg monoclonal mouse anti-human IL-7 antibody (R&D Systems Europe Ltd, Abingdon, United Kingdom)/mL in PBS (Sigma-Aldrich, Gillingham, United Kingdom) and incubated overnight at 4°C. The plates were washed and blocked with PBS/1% bovine serum albumin (BSA). Doubling dilutions were prepared of recombinant human IL-7 in PBS/0.1% BSA to give a standard range from 7.8 to 1000 pg/mL, and 100 µL was added per well. Each breast milk sample was processed in triplicate at 100 µL/well, and plates were incubated at room temperature for 2 h and washed in PBS with 0.5% Tween 20 before the addition to the wells of 100 µL biotinylated goat anti-human IL-7 immunoglobulin G antibody/mL (R&D Systems Europe Ltd) in TBS/0.1% BSA. The plate was incubated at room temperature for 2 h and washed; next, streptavidin-horseradish peroxidase conjugate (R&D Systems Europe Ltd) diluted 1:200 in PBS/0.1% BSA was added. After a 20-min incubation at room temperature, the plates were washed, substrate was added to each well for 30 min, color development was stopped by the addition of 50 µL of 1 mmol H2SO4/L, and the plates were read at 450 nm. Initial analysis showed that IL-7 was stable when frozen and remained so after 2 repeated freeze-thaw treatments, with a sharp decline in detectable concentrations thereafter. The results presented here were obtained from
2 freeze-thaw treatments.
Measurement of sjTRECs
sjTRECs are generated when the T cell receptor (TCR)
locus gene segments (VDJC) are removed from within the TCR
locus during rearrangement of TCR
gene segments (VJC), a phenomenon observed in 70% of
ß T cells (17). DNA was isolated from the frozen whole-blood samples by using the QIAamp DNA Mini Kit (QIAGEN, Crawley, United Kingdom), according to the manufacturer's instructions. The sjTREC concentrations were analyzed according to a previously described method (17) by using real-time polymerase chain reaction (PCR) on a light cycler (Roche Diagnostics, Lewes, United Kingdom). sjTRECs were measured by Hot-start real-time PCR in the light cycler with the use of primers GCCACATCCCTTTCAACCATGCTGAC (forward) and TTGCTCCGTGGTCTGTGCTGGCATC (reverse). A standard was prepared by using serial dilutions of a known number of copies of a fragment of the sjTREC gene sequence and included in each light cycler run to generate a standard curve. Using 0.2-mL PCR tubes on ice, we made a master mix of 2 µL SYBRGreen (Roche Diagnostics), which binds double-stranded DNA, and 0.16 µL of anti-Taq antibody (Sigma Aldrich) and incubated the mix for 10 min at room temperature; then 3.2 µL (4 mmol/L) MgCl2, 0.2 µL (0.4 µmol/L) of each of the primer pairs and 10.64 µL sterile water were combined, and 18 µL of this mixture was pipetted into all tubes followed by 2 µL of standards, samples, or a negative control in corresponding tubes to obtain a 20-µL reaction volume. Real-time PCR was then performed in glass capillaries under the following conditions: 1 cycle of 95°C for 1 s; 5 preamplification cycles of 95°C for 5 s, 60°C for 10 s, 72°C for 12 s, and 83°C for 5 s; and 4060 cycles of second amplification and fluorescence measurement of 95°C for 1 s, 60°C for 5 s, 72°C for 12 s, and 83°C for 5 s, during which fluorescence measurements were taken. The number of copies of sjTRECs in the original samples was automatically determined by reading off the standard curves generated.
Statistical analysis
Data were tested for normal distribution, and nonnormally distributed data were log transformed to achieve normalization. Student's t test was used to compare means, and the 95% CI was calculated. P values of < 0.05 were considered statistically significant. For the breast milk IL-7 enzyme-linked immunosorbent and sjTREC assays, we analyzed each sample in triplicate and observed low CVs; outliers were easily identified and excluded from the analysis.
| RESULTS |
|---|
|
|
|---|
|
|
Variation in lymphocyte counts and T cell numbers by season of birth
To assess possible relations between T cell numbers and sjTRECs, the total lymphocyte and T cell counts were analyzed for all 99 infants included in the sjTREC analysis at age 8 wk. There was some variation in the T cell counts obtained during the harvest- and hungry-season months (Figure 2
), but this difference was not statistically significant for the percentage of CD3+ cells (Table 2
). There was also no significant difference in absolute numbers of CD3+ cells (Table 2
). Total lymphocyte count was, however, significantly higher in the hungry season than in the harvest season (Table 2
).
|
|
| DISCUSSION |
|---|
|
|
|---|
There could be several explanations for the observed increase in thymic size during the harvest season in infants in this community. For instance, it could have been due to increased thymopoiesis, which is shown to result in increased numbers of CD4+ CD8+ (double-positive) thymocytes in the thymic cortex during reversal of starvation-induced thymic involution in ob/ob mice (21), to increased numbers of fat cells (22), or to the possible entry of lymphocytes from the periphery (23). The current finding that the increased thymic size was also associated with increased sjTREC concentrations suggests an association between an improved thymic output and harvest-season births. Although there are other possible explanations for the seasonal differences in sjTREC concentrations, they could plausibly be linked to maternal nutritional status. Improved maternal nutrition during the harvest season may improve the infants' thymic activity through an increase in a factor or factors in breast milk that enhance the generation of thymocyteshence, the observed increase in sjTREC concentrations. We have not used purified peripheral blood mononuclear cells for our sjTREC assay because only frozen whole blood was available, but the use of whole blood was unlikely to introduce errors to the assay because we took care to extract and purify DNA from whole blood by using the QIAamp blood purification kit, which is reliable for the generation of pure PCR-amplifiable DNA from such samples. Because of their restriction to the
ß T cell lineage, it is not necessary to purify CD3+ T cells before their analysis (24). The calculation of sjTREC concentrations per T cell is considered to be an appropriate indicator of changes in thymic function, although its use as a marker for absolute thymic function is controversial, partly because of the influence that T cell proliferation (usually in disease situations) may have on sjTREC concentrations independent of thymic output (25). During an infection, activation of T cells and their expansion to produce effector cells lead to a dilution of the episomal sjTRECs that do not divide with the cell. Therefore, the extent of T cell proliferation must be taken into account in interpreting sjTRECs as a marker of thymic function. The CD3+ cell count does not support any significant dilution of sjTRECs in our analysis, and other peripheral WBCs, such as monocytes, granulocytes, and B cells, are negative for sjTRECs because they are not known to express the TCR; therefore their proliferation is irrelevant to the concentration of sjTRECs per T cell. The analysis of the number of sjTRECs/mL whole blood, which reflects the absolute sjTREC numbers, has also confirmed significantly greater average sjTREC content during the harvest season. Nonetheless, the characteristic rise in infections during the hungry season increases the risk of productive infection and the related possibility of increased T cell proliferation that would result in sjTREC dilution. Although these possibilities may exist for many persons in the study community, they were considered unlikely for those at the specific age of 8 wk, when exclusive breastfeeding was practiced, the infants had good weight and diminished prevalence of infections, and they appeared healthy. Taken together, our data imply that the higher sjTREC counts of the harvest season were a likely reflection of the greater number of recent thymic emigrants in the harvest-season infants than in the hungry-season infants.
The crude division of the year into the harvest and hungry seasons was limited by sample size considerations, and thus inevitable overlaps may have diluted some of the statistical power in the correlations of the immunologic values measured with thymic size. A closer look at the months of September, October, and November, which fall within or immediately after the peak of the rainy season with its high prevalence of malaria and other infections, found that they coincided with the observed increases in lymphocyte counts. The slightly higher CD3+ T cell count of these months (Figure 2
) could be attributed to the relative increases in proliferation of these cells that is driven by the antigenic load from the endemicity of various infections at this time (16). The higher total lymphocyte counts at this time may be due to expansions in the B lymphocyte population that are often associated with malaria infection and associated diseases (26, 27). This period is also the height of the hungry season, during which more extreme nutritional deprivation is expected to further suppress the thymus and lead to additional lowering of thymic output. That is evidenced by the occurrence of the lowest sjTREC concentrations during these months, which is consistent with findings that nutritional rehabilitation of malnourished children resulted in greater thymic size and improved immunologic function (28) and that the reverse was true during dietary restriction (29).
Although maternal immune factors and cytokines may affect the fetus via the intrauterine route (30), detection in the harvest season of higher concentrations of breast milk IL-7 at 1 wk postpartum and of evidence of improved thymic activity in exclusively breastfed infants at age 8 wk suggested that the composition of the food originating from the mother and possibly reflecting her own nutritional status may be linked to the enhancement of the infant's developing immune system. IL-7 is essential for the proliferation and survival of precursor T cells, which show elevated sensitivity to IL-7 during the earliest stages of thymocyte development (31, 32). Once these precursors, which are committed to the T cell lineage, mature and exit the thymus as recent thymic emigrants, IL-7 also induces their proliferation and survival, which maintain the T cell repertoire (33). It was shown recently that homeostatic control of the memory CD4+ T cell pool is also regulated by IL-7 and does not require IL-15, unlike that of memory CD8+ T cells (34). These findings emphasize the importance of IL-7 in all stages of T cell development, with particular relevance to the maturing immune system in early life. Although breast milk is known to contain a number of cytokines and growth factors (35), this report is the first that it contains IL-7 and that there are variations in the IL-7 concentrations. The presence of IL-7 in breast milk was not necessarily predictable because IL-7 was previously reported to be produced by stromal cells of the thymus (36), bone marrow (37), and dendritic cells (38). However, active secretion of other cytokines, including IL-18 and transforming growth factor ß, in breast milk has been reported (35, 39, 40), and it has been suggested that cytokines made elsewhere in the body may home to the mammary gland (41).
A role for breast milk in the improvement of thymic function has been implicated in findings that breastfeeding is associated with greater thymic size in infancy than is feeding with formula milk (42). Although transfer of the IL-7 from the breast milk across the gut and then onward to the infant's thymus may seem difficult, it has been shown that breast milk fat globules contain proteins known to resist the infant's gut digestive enzymes and hence to remain functionally active (43). Furthermore, soluble receptors of cytokines known to bind their ligands may then act as carrier proteins, which results in more stable receptor-cytokine complexes with an extended half-life (44). Preliminary analysis of our results indicates that breast milk IL-7R
concentrations followed a pattern similar to that of the cytokine, which may further favor successful transfer of viable IL-7 to the infant via breast milk. Receptors for cytokines are known to exist in the gut (45), and cryptopatches, which are part of the murine intestinal immune compartment, express the IL-7 receptor (46); this suggests that IL-7 receptors may also exist in the human gut and that breast milk IL-7 may cross the gut epithelium into the circulation via these receptors. Immune compartments such as Peyer's patches (47, 48) and M cells (4850) are known transfer routes for gut proteins. The presence in the thymus of IL-7 receptors and the high density of cells with increased sensitivity to IL-7 (51) make it possible that any IL-7 crossing into the infant's circulation will affect these thymocytes.
Although by no means conclusive, this study suggests a possible mechanistic route through which external factors (including maternal nutritional restriction) during the hungry season may affect IL-7 concentrations (or related trophic factors) in breast milk, which in turn may influence thymic size and thymopoiesis in early infancy. We showed elsewhere that infants have a characteristic thymic size that tracks through infancy, even after adjustment for body weight (10). It is plausible that such early variations may represent a permanent programming of thymic development, which in turn could influence adult T cell function through differences in T cell pool size, repertoire, or both. The accumulated effects of these events is predicted to precipitate premature immune senescence by inducing accelerated T cell division with age as a response to the disproportionate pressures on an immune system that is fundamentally inhibited by early-life events. We are currently investigating these possibilities in a cohort of older subjects from the same community.
| ACKNOWLEDGMENTS |
|---|
PTN, JP-L, and SMH carried out the assays; ACC organized the fieldwork and sample collection; and AMP and RA designed the study. None of the authors had any conflict of interest with the study.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. Raqib, D. S Alam, P. Sarker, S. M. Ahmad, G. Ara, M. Yunus, S. E Moore, and G. Fuchs Low birth weight is associated with altered immune function in rural Bangladeshi children: a birth cohort study Am. J. Clinical Nutrition, March 1, 2007; 85(3): 845 - 852. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ghattas, D. L Wallace, J. A Solon, S. M Henson, Y. Zhang, P. T Ngom, R. Aspinall, G. Morgan, G. E Griffin, A. M Prentice, et al. Long-term effects of perinatal nutrition on T lymphocyte kinetics in young Gambian men Am. J. Clinical Nutrition, February 1, 2007; 85(2): 480 - 487. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Herndler-Brandstetter, S. Schwaiger, E. Veel, C. Fehrer, D. P. Cioca, G. Almanzar, M. Keller, G. Pfister, W. Parson, R. Wurzner, et al. CD25-Expressing CD8+ T Cells Are Potent Memory Cells in Old Age J. Immunol., August 1, 2005; 175(3): 1566 - 1574. [Abstract] [Full Text] [PDF] |
||||
![]() |
A M Prentice and S E Moore Early programming of adult diseases in resource poor countries Arch. Dis. Child., April 1, 2005; 90(4): 429 - 432. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |