AJCN Tufts Nutrition Symposium, Boston & Online Sept 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ortega, H.
Right arrow Articles by Lasunción, M. A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ortega, H.
Right arrow Articles by Lasunción, M. A
Agricola
Right arrow Articles by Ortega, H.
Right arrow Articles by Lasunción, M. A
American Journal of Clinical Nutrition, Vol. 81, No. 3, 624-632, March 2005
© 2005 American Society for Clinical Nutrition

ORIGINAL RESEARCH COMMUNICATION

Influence of apolipoprotein E genotype on fat-soluble plasma antioxidants in Spanish children1,2,3

Henar Ortega, Patricia Castilla, Diego Gómez-Coronado, Carmen Garcés, Mercedes Benavente, Fernando Rodríguez-Artalejo, Manuel de Oya and Miguel A Lasunción

1 From the Servicio de Bioquímica-Investigación, Hospital Ramón y Cajal, Madrid, Spain (HO, PC, DG-C, and MAL); the Departamento de Bioquímica y Biología Molecular, Universidad de Alcalá, Alcalá de Henares, Spain (MAL); Unidad de Lípidos, Fundación Jiménez Díaz, Universidad Autónoma de Madrid, Spain (CG, MB, and MdO); and the Departamento de Medicina Preventiva y Salud Pública, Universidad Autónoma de Madrid, Spain (FR-A)

2 Supported by grants from the Comunidad de Madrid (08.4/0006/1997) and Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (VIN00-004 and VIN03-0027), Spain.

3 Reprints not available. Address correspondence to Miguel A Lasunción, Servicio de Bioquímica-Investigación, Hospital Ramón y Cajal, Ctra de Colmenar, km 9, E-28034 Madrid, Spain. E-mail: miguel.a.lasuncion{at}hrc.es.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Background:Apolipoprotein (apo) E is a major determinant of plasma lipid concentrations, which in turn influence the plasma concentrations of various fat-soluble vitamins.

Objective:We aimed to analyze the effect of APOE genotype on fat-soluble antioxidant concentrations in children.

Design:A total of 926 healthy boys and girls aged 6–8 y were selected from 4 cities in Spain. APOE genotyping was carried out, and plasma concentrations of lipids, apolipoproteins, and lipid-soluble antioxidants were measured.

Results:Plasma lipid concentrations were strongly influenced by APOE genotype. The mean plasma concentration of {alpha}-tocopherol was 21.3 µmol/L, which is one of the highest values ever reported for a population of children. Although plasma concentrations of {alpha}-tocopherol, {gamma}-tocopherol, lycopene, and {alpha}-carotene varied significantly between subjects with different APOE genotypes, most of these differences disappeared after adjustment for lipoprotein-related covariates. Nevertheless, tocopherol concentrations remained elevated in individuals with the E2/2 genotype. Multivariate regression analysis showed interactions of APOE genotype with triacylglycerol and apo B in determining {alpha}-tocopherol concentrations. When subjects were stratified according to major apo E groups, apo B appeared to be the most important predictor of {alpha}-tocopherol concentrations in all groups, whereas triacylglycerol was identified only in carriers of the E2 allele.

Conclusions:The association between APOE genotype and lipophilic antioxidant concentrations is dependent mainly on the effect of the polymorphism on lipoprotein concentrations. However, triacylglycerol plays a role in determining the variability of {alpha}-tocopherol concentrations in E2 carriers only. This suggests that the {alpha}-tocopherol content in each lipoprotein class varies according to APOE genotype.

Key Words: Apolipoprotein E • tocopherols • carotenoids • antioxidants • lipoproteins • children


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Oxidative stress is believed to underlie most prevalent chronic diseases in industrialized countries, such as cancer, atherosclerosis, and neurodegenerative diseases (1–3). Although morbidity occurs mainly at advanced ages, nutritional factors operating in childhood, which possibly interact with genetic factors, may also contribute to the development of such diseases.

In plasma, lipoprotein-bound tocopherols and carotenoids protect fatty acids from peroxidation, thereby preserving their function and the normal fate of lipoprotein particles. Plasma concentrations of vitamin E and carotenoids are correlated with those of plasma lipids (4), which in turn are affected by genetic factors, such as the polymorphism associated with the APOE gene. Apolipoprotein E (apo E) modulates the hepatic binding, uptake, and catabolism of several classes of lipoproteins (5, 6). Three major isoforms, referred to as apo E2, E3, and E4 and which are encoded by alleles {epsilon}2, {epsilon}3, and {epsilon}4 respectively, have been identified, but their frequencies vary between populations. In particular, the frequency of {epsilon}4 in northern Europe and North America is significantly higher than in Mediterranean or Asian countries (5, 7–9). Possession of the apo E4 form increases both total and LDL-cholesterol concentrations over those seen with apo E3, whereas apo E2 has the opposite effect (5, 10). This effect of the apo E polymorphism may be modulated by other factors, such as sex (9–11) and alcohol intake (12). Taking {epsilon}3 allele homozygosity as a reference, we found that in children, the presence of the {epsilon}2 allele lowers LDL-cholesterol and apo B plasma concentrations by 18% and 19%, respectively, whereas the presence of the {epsilon}4 allele significantly increases these variables by 7% and 8%, respectively (13).

In addition to modulation of lipoprotein metabolism, apo E appears to have other functions in the organism (6, 14). In particular, it protects against lipid peroxidation; apo E2 exhibits the highest antioxidant activity, followed by apo E3 and then apo E4 (15, 16). This may be relevant to the association between the {epsilon}4 allele and the risk of Alzheimer disease (17). In this context, it has been suggested that APOE genotyping may have medical applications in the identification of patient subgroups susceptible to oxidative damage who could then be treated with antioxidant vitamins (18).

In adult subjects, lipid-adjusted vitamin E plasma concentrations appear not to differ between the major apo E phenotypes (19). However, an association of vitamin A with the apo E polymorphism was found in women, with apo E2 carriers exhibiting a slightly higher concentration than other subjects (19). These results indicate an influence of the apo E polymorphism on antioxidant vitamins, which may be modulated by sex (19).

In the present work, we analyze the influence of APOE genotype on plasma concentrations of tocopherols, carotenoids, and retinol in a large prepubertal infant population free of an established hormonal influence. This is also the first survey of fat-soluble antioxidant status in Spanish children.


   SUBJECTS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Subjects
This work forms part of the Four Provinces Study, a large-scale study designed to analyze cardiovascular disease risk factors in Spain by studying children from 4 large metropolitan areas of the country. In the present study, a total of 926 healthy children, 441 boys and 485 girls, aged 6–8 y (boys, 6.66 ± 0.64 y; girls, 6.70 ± 0.63 y; ± SD; P > 0.05) were studied. All the subjects were free of ischemic heart disease and any other endocrine, metabolic, hepatic, or renal disorder. The study protocol was approved by the Clinical Investigation Ethics Committee of the Fundación Jiménez Díaz. The work is consistent with the principles contained within the Declaration of Helsinki and subsequent reviews, as well as the prevailing Spanish legislation on clinical research in human subjects. Parents were required to sign a written consent for their child's inclusion in the study. A team consisting of one physician and several nurses (who were responsible for blood extractions and physical measurements) was in charge of the fieldwork. Details of sample selection are published elsewhere (13).

Methods
Weight was measured to the nearest 0.1 kg and height was measured to the nearest 0.1 cm. Body mass index (BMI; weight in kilograms divided by height in meters squared, ie, kg/m2) was calculated from these parameters. No statistically significant differences in BMI were found between the boys and the girls (boys, 16.9 ± 2.4; girls, 17.0 ± 2.6; ± SD; P > 0.05). The percentage of subjects classified as overweight (BMI > 20.1) was 11.5% in boys and 12.6% in girls (P > 0.05).

The children were asked to fast overnight. Venous blood samples were then obtained early in the morning by venipuncture into evacuated tubes containing EDTA-Na2 as an anticoagulant, placed on ice, and centrifuged immediately at 1500 x g, 4 °C, for 25 min. The plasma was separated and used for biochemical determinations, and the cells were kept frozen at –70 °C for subsequent DNA extraction. Cholesterol and triacylglycerols were measured enzymatically (Menarini Diagnostics, Firenze, Italy) with an RA-1000 Autoanalyzer (Technicon Ltd, Dublin, Ireland). HDL cholesterol was measured after precipitation of apo B–containing lipoproteins with phosphotungstic acid and magnesium (Roche Diagnostics, Madrid, Spain). LDL cholesterol was calculated according to Friedewald's formula. Plasma apo A-I and apo B concentrations were measured by immunonephelometry (Dade Berhing, Frankfurt, Germany). The interassay CVs were as follows: cholesterol, 1.4%; triacylglycerol, 1.7%; apo A-I, 1.55%; and apo B, 4.8%.

Plasma {alpha}-tocopherol, {gamma}-tocopherol, lycopene, {alpha}-carotene, ß-carotene, and retinol were measured by gradient HPLC (Beckman Instruments, Palo Alto, CA) after extraction with hexane, as described elsewhere (20). Retinol acetate and tocopherol acetate were used as internal standards. The standard reference material SRM 968c from the National Institute of Standards and Technology (Gaithersburg, MD) was used as a control. The interassay CVs were as follows: {alpha}-tocopherol, 5.0%; {gamma}-tocopherol, 12.5%; lycopene, 5.5%; {alpha}-carotene, 8.8%; ß-carotene, 7.8%; and retinol, 4.4%.

Genomic DNA was prepared from leukocytes as described previously (13). For APOE genotyping, DNA was amplified by polymerase chain reaction by using the primers 5CGGGCACGGCTGTCCAAGGAG3 and 5CAGCGCGCCCTGTTCCACGAG3. The 244–base pair amplicon was restricted with HhaI, and the DNA fragments were separated by 8%-polyacrylamide gel electrophoresis. APOE genotype was determined by comparison with the combination of fragment sizes described by Hixson and Vernier (21).

Statistics
Statistical analyses were performed by using the software packages SPSS, version 9.0, and STATGRAPHICS PLUS, version 4.1. Analysis of variance (ANOVA) was used to examine the effects of APOE genotype after adjustment for possible confounding factors (sex, age, BMI, and city of origin). Post hoc multiple comparisons were performed with Tukey's test. Given their skewed distribution, concentrations of triacylglycerol, {gamma}-tocopherol, lycopene, {alpha}-carotene, and ß-carotene were log transformed before statistical comparison.

Pearson correlation coefficients were calculated to evaluate the correlations between fat-soluble antioxidants and lipid variables by using the log-transformed data as indicated. To ascertain the independent predictors of fat-soluble plasma antioxidants, stepwise multiple regression analysis was performed. For this, the independent variables were selected from among the anthropometric variables and plasma lipid and apolipoprotein concentrations by backward selection. To judge the relative importance of the selected independent variables in light of the noise in the data, the component effect of each predictor was calculated as coefficient x (X – Xbar), where coefficient is the estimated ß coefficient of the variable and Xbar is the sample mean of that variable. The APOE genotype was represented as 2 dummy variables, each coded with the number (0, 1, or 2) of alleles of {epsilon}2 and {epsilon}4, respectively, in each genotype. An F ratio was used to test the fit of the models. Interactions were analyzed by including interaction terms in the model. A partial F was used to test the statistical significance of these terms to improve the model.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Plasma concentrations of lipids and apolipoproteins in the children studied are shown in Table 1Go. The mean cholesterol concentration in the whole group was 4.70 mmol/L. Thirty-one children (3.35%) had an LDL-cholesterol concentration > 4.14 mmol/L (160 mg/dL) and 19 children (2.05%) had HDL-cholesterol concentrations < 0.90 mmol/L (35 mg/dL), which are considered risk factors for cardiovascular disease in adults. However, none of the children had the 2 risk factors simultaneously. When lipid values in boys and girls were compared, no significant differences were found for total cholesterol or HDL cholesterol; however, concentrations of LDL cholesterol, apo B, and total triacylglycerol were slightly but significantly higher in girls than in boys (Table 1Go).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Plasma concentrations of lipids, apolipoproteins, and antioxidants in children1

 
Plasma concentrations of fat-soluble antioxidants are also shown in Table 1Go. Of the 926 children studied, 69 were occasionally given multivitamin supplements. There were no significant differences in the means of any of the measured plasma analytes, vitamins included, between children consuming and those not consuming supplements (data not shown); consequently, the results were combined. In the population as a whole, plasma {alpha}-tocopherol concentrations varied from 8.49 to 40.02 µmol/L, with a mean of 21.3 µmol/L. Four (0.4%) children had a total vitamin E concentration, calculated as the sum of both {alpha}- and {gamma}-tocopherol, <11.6 µmol/L, which is considered to indicate vitamin E deficiency in adults. The mean plasma concentration of {alpha}-tocopherol was significantly higher in girls than in boys. This is likely a consequence of the different number of circulating lipoprotein particles, because no significant difference in {alpha}-tocopherol concentration was noted after adjustment for apo B (21.4 ± 0.16 and 21.0 ± 0.17 µmol/L in boys and girls, respectively; P > 0.05). No sex effects were found for the rest of the antioxidants. The mean retinol concentration in the whole group was 1.02 µmol/L (range: 0.34 to 2.25 µmol/L). One child had a severely reduced retinol concentration (0.34 µmol/L), whereas 63 subjects (6.8%) had values below the clinically significant concentration of 0.7 µmol/L.

The distribution of APOE genotypes in the study population was as follows: E2/2, 0.65%; E3/2, 9.61%; E3/3, 71.27%; E4/3, 16.20%; E4/2, 0.86%; and E4/4, 1.40%. The allele frequencies were 5.9% for {epsilon}2, 85.0% for {epsilon}3, and 9.1% for {epsilon}4, which are similar to those previously reported in both Spanish (9) and other Mediterranean (7, 8) populations. Analysis of the effect of APOE genotype on plasma lipid concentrations was performed by ANOVA on the whole group of children after adjustment for age, sex, city of origin, and BMI. As shown in Table 2Go, APOE genotype influenced most of the plasma lipid concentrations as well as those of apolipoproteins. The effect on triacylglycerol was moderate, both E2 and E4 homozygotes having significantly higher concentrations than did the other groups. In contrast, total cholesterol, LDL-cholesterol, and apo B concentrations were strongly influenced by APOE genotype. The highest mean values were observed in the E4 homozygotes, followed by the E4/3 subjects; the lowest values were observed in the E2 carriers. Concentrations of LDL cholesterol and apo B in E4/4 subjects were approximately twice those in E2/2 subjects. HDL was not influenced extensively by APOE genotype; actually, a significant effect was observed only for the apo A-I plasma concentration and not for HDL cholesterol (Table 2Go). In general terms, E2 carriers had the highest and E4 heterozygotes the lowest apo A-I concentrations. However, apo A-I concentrations in E4/4 subjects were not significantly different from those in E2/2 subjects (Table 2Go).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Plasma concentrations of lipids and apolipoproteins by apolipoprotein E (APOE) genotype in children1

 
Plasma concentrations of fat-soluble vitamins according to APOE genotype are shown in Table 3Go. The ranges shown (minimum, maximum) correspond to original, not transformed, values, whereas means and CIs were calculated after adjustment for age, sex, city of origin, and BMI to perform statistical comparisons. Plasma concentrations of the main lipoprotein-bound antioxidants were influenced by APOE genotype. Concentrations of {alpha}-tocopherol, {gamma}-tocopherol, lycopene, and {alpha}-carotene were significantly lower in E3/2 than in E3/3 individuals. A similar trend was observed for ß-carotene, but the differences between the different APOE genotypes were not significant. Curiously, E3/2 subjects had significantly lower concentrations of both tocopherols than did E2 homozygous subjects. Finally, retinol concentrations did not differ significantly between genotypes.


View this table:
[in this window]
[in a new window]
  		TABLE 3. Plasma concentrations of fat-soluble vitamins by apolipoprotein E (APOE) genotype in children1

 
Pearson's correlation coefficients between plasma vitamins and lipids and apolipoproteins are shown in Table 4Go. As expected, plasma concentrations of lipoprotein-bound fat-soluble antioxidants correlated with those of plasma lipids and apolipoproteins, particularly cholesterol and apo B. On the other hand, {alpha}-tocopherol was the antioxidant whose concentration was most significantly correlated with that of lipids and apolipoproteins. {alpha}-Tocopherol concentrations were also positively correlated with the ratio of HDL cholesterol to apo A-I but were negatively correlated with the ratio of LDL cholesterol to apo B. {gamma}-Tocopherol concentrations were correlated with those of total cholesterol, LDL cholesterol, and apo B. Concentrations of lycopene and carotenes were positively correlated with those of total cholesterol and lipoprotein-cholesterol, as well as with apolipoproteins A-I and B, but not with triacylglycerol. In general, the correlation coefficients were higher with apolipoproteins than with their cholesterol counterpart, ie, apo B versus LDL cholesterol and apo A-I versus HDL cholesterol, for each fat-soluble vitamin studied, including retinol. Plasma concentrations of retinol, a vitamin transported bound to retinol-binding protein rather than in lipoproteins in fasting plasma, showed a positive correlation with all lipids and apolipoproteins studied and a negative correlation with the ratio of LDL cholesterol to apo B (Table 4Go).


View this table:
[in this window]
[in a new window]
  		TABLE 4. Pearson correlation coefficients between plasma concentrations of fat-soluble antioxidants and lipids and apolipoproteins in children1

 
Food consumption in children was estimated on the basis of a food-frequency questionnaire completed by their parents; these results are published elsewhere (22, 23). No significant correlations were found between fat-soluble plasma antioxidants and any of the major diet components considered, namely, energy, protein, fat, carbohydrates, fiber, and saturated, monounsaturated, or polyunsaturated fatty acids (data not shown). Moreover, neither tocopherol nor retinol plasma concentrations were significantly correlated with estimated vitamin E or vitamin A dietary consumption (data not shown).

We next analyzed the predictors of plasma fat-soluble antioxidant concentrations by multiple linear regression and backward selection. The following variables were included as independent variables: total triacylglycerol, which provides an estimate of VLDL cholesterol (24); LDL cholesterol; HDL cholesterol; apo A-I; and apo B plasma concentrations. The selected variables and their standardized coefficients (ß) and P values, along with the R2 values of the models are given in Table 5Go. For {alpha}-tocopherol, the identified predictors were total triacylglycerol, apo A-I, and apo B, with the model explaining as much as 27.6% of the variability in plasma {alpha}-tocopherol concentrations. In the case of {gamma}-tocopherol, the only identified predictor was apo B. Lycopene, {alpha}-carotene, and ß-carotene concentrations were predicted by both apo A-I and apo B, although the magnitude of the effects of these apolipoproteins was much lower than in the case of {alpha}-tocopherol, as indicated by the ß coefficients. Retinol concentration was predicted by apo A-I and apo B, and, to a lesser extent, by LDL cholesterol. Finally, the resulting models for {gamma}-tocopherol, lycopene, carotenes, and retinol explained a much lower variability of their respective concentrations than in the case of {alpha}-tocopherol.


View this table:
[in this window]
[in a new window]
  		TABLE 5. Multiple regression analysis with backward selection1

 
The results of the multivariate analysis prompted us to adjust fat-soluble antioxidant concentrations for triacylglycerols, apo A-I, and apo B to evaluate a possible lipoprotein-independent effect of APOE genotype. As shown in Table 6Go, a significant effect of APOE genotype was still noted for vitamin E. In the case of {alpha}-tocopherol, the highest concentration was found in E2/2 individuals, whereas no significant differences were observed between the other genotypes. A similar trend was observed for {gamma}-tocopherol. Significant associations between lycopene or carotenes and APOE genotype were no longer observed after adjustment for apo A-I and apo B. This indicates that the differences in carotenoid concentrations between individuals with different APOE genotypes are mainly attributable to the number of circulating lipoprotein particles. Similarly, no significant variation in retinol concentrations was found between different APOE genotypes after adjustment for significant covariates.


View this table:
[in this window]
[in a new window]
  		TABLE 6. Plasma concentrations of lipids and apolipoproteins by apolipoprotein E (APOE) genotype in children1

 
We examined a possible interaction between APOE genotype and lipoprotein-related variables in determining the concentration of {alpha}-tocopherol, the antioxidant most influenced by such variables. To this end, the effects of the {epsilon}2 and {epsilon}4 alleles, as compared with the {epsilon}3 allele, as well as the interacting terms of the {epsilon}2 and {epsilon}4 alleles with triacylglycerol, apo A-I, or apo B, were determined. Significant interactions of APOE genotype with triacylglycerol (P < 0.05) and apo B (P < 0.05), but not with apo A-I, were found. Regarding the ß coefficients for the individual interacting terms, a significant interaction was found only between the {epsilon}2 allele and triacylglycerol (ß = 2.318, P < 0.05). To further examine the effect of triacylglycerol and apo B on {alpha}-tocopherol concentrations in each individual genotype, a multiple regression analysis was performed, but now stratifying for APOE genotype. Because of the small number of subjects in certain genotypes, they were grouped into E2 carriers (comprising E2/2 and E3/2 subjects), E3 homozygotes, and E4 carriers (E4/4 and E4/3 subjects); E4/2 subjects were excluded from this analysis. The component effects of triacylglycerols and apo B are shown in Figure 1Go. Apo B was identified as a significant predictor of {alpha}-tocopherol in all groups, However, clear differences were found for the other lipoprotein-related variables. Triacylglycerol was identified as a significant predictor of {alpha}-tocopherol concentrations in the E2 subjects but not in the E3 and E4 groups (Figure 1Go), which confirms the interaction between the {epsilon}2 allele and triacylglycerol. In fact, the association between triacylglycerol and {alpha}-tocopherol in the whole population (Table 5Go) was attributable specifically to the E2 subjects, because it did not persist after this group was eliminated from the multivariate analysis (data not shown).



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 1.. Component effects of triacylglycerol and apolipoprotein (apo) B on the plasma {alpha}-tocopherol concentration by apolipoprotein E (APOE) genotype. Multiple linear regression was performed considering {alpha}-tocopherol as the dependent variable and triacylglycerol, apo B, and apo A-I as the independent variables for each genotype: E2 carriers (E2/2 and E3/2 subjects), E3 homozygotes, and E4 carriers (E4/4 and E4/3 subjects). Given that interactions of APOE genotype with both triacylglycerol and apo B were significant (P < 0.05) but that those with apo A-I were not (P > 0.05), only the component effects for triacylglycerol and apo B were calculated after backward selection. Individual points are plotted around the component line by adding each residual to the component effect. The ß coefficient and P value of each predictor and the R2 and P value of the model are also shown. Mean (±SE) plasma concentrations in these groups were as follows (means with different superscript letters are significantly different): triacylglycerol (mmol/L)—E2, 0.851 ± 0.027 (n = 95); E3, 0.829 ± 0.010 (n = 660); E4, 0.853 ± 0.021 (n = 163) (NS); apo B (g/L)—E2, 0.554 ± 0.014a; E3, 0.710 ± 0.005b; E4, 0.770 ± 0.011c (P < 0.001).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Few published reports exist on fat-soluble antioxidant plasma concentrations in prepubertal children in developed countries; the work presented here is the first study of such characteristics conducted in Spain. Total vitamin E concentrations were similar to values reported in Italian children (25) but were higher than values found in other countries (26–33), with only 4 children (0.4%) having vitamin E concentrations sufficiently low to be considered deficient. Other authors reported a prevalence of vitamin E deficiency in children: ranging from none in France (28) to >30% in the United States (34, 35). The variability in plasma lipid concentrations among populations may contribute to these differences. Furthermore, the {alpha}-tocopherol/(cholesterol + tri-acylglycerol) ratio in our population of children remained relatively high (3.87 ± 0.67 µmol/mmol; ± SD), and none of the children studied had a ratio <1.59, which is considered an accurate index of the risk of vitamin E deficiency (36).

The plasma retinol concentration in Spanish children appears to be similar to that in children in other countries when the same age groups are compared (27, 28, 30, 33, 37–39). In our population, only one child (0.1%) had a retinol concentration <0.35 µmol/L, which could be considered to indicate a high risk of anemia (40), and 6.8% had values below the clinically significant concentration of 0.7 µmol/L. In other countries, the proportion of children with concentrations <0.7 µmol/L was reported to be between 0% and 11.6% (27, 28, 30, 33, 37, 38). In general, children from less developed areas had, on average, lower plasma retinol concentrations than did children with higher living standards. Moreover, we found a positive correlation between the plasma retinol concentration and BMI (r = 0.1531, P < 0.001) in our study population. Thus, both living standards and lower BMI may contribute to explaining the relatively high proportion of subjects in our population with retinol concentrations <0.7 µmol/L (6.8%).

In general, carbohydrate intake in this sample of children was lower, whereas protein and fat intakes were higher, than current dietary recommendations (22). Dietary consumption of vitamin A (667 ± 196 µg/d; ± SD) and vitamin E (11.0 ± 4.1 mg/d; ± SD) was well above current recommendations. However, we did not find any significant correlation between fat-soluble plasma antioxidants and the major nutrients or vitamins consumed. Other authors also reported no association between dietary intake and plasma concentrations of retinol in well-nourished populations (41, 42). The results of studies of adult populations that addressed the influence of diet on serum tocopherol are conflicting: some authors reported a small association of dietary intake of vitamin E with serum {alpha}-tocopherol concentrations (43–46), whereas others found no significant association (4, 42, 47–49). Nevertheless, when multivitamin users were included in the analysis and total vitamin E intake was calculated, a positive association between this variable and plasma {alpha}-tocopherol was consistently found (42, 46). Supplemental vitamin E intake is in fact the strongest predictor of high serum {alpha}-tocopherol concentrations (46). In the present study, however, the plasma {alpha}-tocopherol concentration in supplement users was not significantly different from that in nonusers (21.4 ± 0.64 compared with 21.2 ± 0.14 µmol/L, respectively; P > 0.05). Note that consumption of supplements by children was irregular in both time and type of tablets, which hampered the evaluation of the actual intake of supplemental {alpha}-tocopherol.

The mean plasma concentration of ß-carotene in our child population was 0.201 µmol/L. Reported values for children of similar age in other countries range from 0.18 to 2.22 µmol/L (28, 30, 32, 33). The reasons for this large variation in ß-carotene concentrations are not clear, although different methods and standardization cannot be discounted. In adults, the plasma concentration of ß-carotene in volunteers from Spain was reported to be the lowest among 5 European countries (50), which is consistent with our results in prepubertal children. To our knowledge, no data on plasma concentrations of the other carotenoids in prepubertal children are available for comparison.

In the present study, the mean retinol concentration in boys was not significantly different from that in girls, which agrees with previous data (32, 33). This is in contrast with adults, for whom men have higher values than do women (19, 41, 42), and suggests an effect of endocrine maturation on the plasma retinol concentration.

In general, concentrations of all the lipoprotein-bound antioxidants were strongly correlated with those of plasma lipids and especially with the most abundant apolipoproteins, apo A-I and apo B. In multivariate linear regression analysis, apo A-I and apo B were identified as predictors instead of the cholesterol moiety of the respective lipoproteins (ie, HDL and LDL) for all the antioxidants measured. This indicates that the principal determining factor of the plasma concentration of these antioxidants is the number of lipoprotein particles carrying them, rather than the lipid (cholesterol) content of the lipoproteins.

When the role of the apo E polymorphism in determining the variability in antioxidant concentrations was assessed, the results essentially agreed with other reports in children (51–54). Concentrations of {gamma}-tocopherol, lycopene, {alpha}-carotene, and, most significantly, {alpha}-tocopherol varied as a function of APOE genotype (Table 3Go). However, these differences were attenuated or disappeared after adjustment for lipoprotein-related variables (Table 6Go). Despite this, interactions of the polymorphism with triacylglycerol and apo B in determining the concentration of {alpha}-tocopherol were found. Taking into account the respective ß coefficients and plasma concentrations of the predictors, the main predictor of the {alpha}-tocopherol concentration in every APOE genotype was apo B, which mainly reflects the number of circulating LDL particles. In the E2 carriers, but not in the other subjects, triacylglycerol was also identified as a predictor of the {alpha}-tocopherol concentration. Given that in the E2 subjects LDL cholesterol and apo B concentrations are lower than in the other groups, such an association with triacylglycerols suggests a redistribution of {alpha}-tocopherol, shifting from LDL to VLDL. This phenomenon was more marked in the E2/2 subjects, whose {alpha}-tocopherol and triacylglycerol concentrations were the highest and whose LDL cholesterol and apo B were the lowest. This is probably the result of the tocopherol transfer protein–mediated incorporation of {alpha}-tocopherol into VLDL (55, 56), the production of which is increased in E2 homozygotes (57).

Both apo A-I and apo B were identified as predictors of carotenoid concentrations, although the effect of these apolipoproteins on the concentration of carotenoids was much lower than on the concentration of {alpha}-tocopherol. Moreover, this contribution was essentially the same in E3/3 subjects as in E2 or E4 carriers (data not shown). Goulinet and Chapman (58) showed that whereas carotenoids are present in all lipoprotein classes, the content in VLDL is much lower than in other classes, which is consistent with plasma triacylglycerol not being identified as a predictor of carotenoid concentrations.

Apo E isoforms have been shown to confer differential protection against free radicals, the highest activity being exhibited by apo E2 and the lowest by the E4 isoform (15, 16). After adjustment for lipids, the mean plasma {alpha}-tocopherol concentration in E4 carriers was not significantly different from that in E3 homozygotes, both in prepubertal children (present work) and in adults (19). However, the threshold of vitamin E deficiency and the appropriateness of vitamin E supplementation in E4/4 individuals, who are at high risk of various degenerative diseases (5, 59), should be reevaluated in clinical assays because of the decreased antioxidant capacity of apo E4.

In summary, the association of the APOE genotype with lipophilic antioxidant concentrations in the population of children studied here was mainly dependent on the effect of the polymorphism on lipoprotein concentrations. Apo B is the main predictor of {alpha}-tocopherol concentrations; however, an interaction exists between certain lipoprotein-related variables and the APOE genotype. In the E2 carriers, but not in the other subjects, triacylglycerols determine the variability of {alpha}-tocopherol concentrations. This suggests that the content of this antioxidant in each lipoprotein class may vary according to the specific APOE genotype, a possibility that should be confirmed by future studies.


   ACKNOWLEDGMENTS
 
We thank O Fernández (Hospital Cristal Piñor, Orense), A Mangas and A Macias (Universidad de Cádiz), and Jacinto Fernández Pardo (Hospital Clínico de Murcia) for the recruitment of the children; Miguel Martín and Sara Guerras for technical assistance; and Victor Abraira for statistical advice. We also thank Iain Patten and Olive Waldron for editorial help.

HO performed the vitamin determinations and sample collection. PC contributed to the vitamin determinations. DG-C contributed to the writing of the manuscript. CG and MB contributed to sample collection and performed APOE genotyping. FR-A contributed to diet analysis. MdO contributed to the design and general management of the Four Provinces Study. MAL contributed to biochemical analysis, supervised the study, and wrote the manuscript. None of the authors had any financial or personal conflicts of interest.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Pryor WA. Vitamin E and heart disease: basic science to clinical intervention trials. Free Radic Biol Med 2000;28:141–64.[Medline]
  2. Arlt S, Beisiegel U, Kontush A. Lipid peroxidation in neurodegeneration: new insights into Alzheimer's disease. Curr Opin Lipidol 2002;13:289–94.[Medline]
  3. Behrend L, Henderson G, Zwacka RM. Reactive oxygen species in oncogenic transformation. Biochem Soc Trans 2003;31:1441–4.[Medline]
  4. Vogel S, Contois JH, Tucker KL, Wilson PW, Schaefer EJ, Lammi-Keefe CJ. Plasma retinol and plasma and lipoprotein tocopherol and carotenoid concentrations in healthy elderly participants of the Framingham Heart Study. Am J Clin Nutr 1997;66:950–8.[Abstract/Free Full Text]
  5. Davignon J, Gregg RE, Sing CF. Apolipoprotein E polymorphism and atherosclerosis. Arteriosclerosis 1988;8:1–21.[Abstract/Free Full Text]
  6. Utermann G. Alzheimer's disease. The apolipoprotein E connection. Curr Biol 1994;4:362–5.[Medline]
  7. James RW, Boemi M, Giansanti R, Fumelli P, Pometta D. Underexpression of the apolipoprotein E4 isoform in an Italian population. Arterioscler Thromb 1993;13:1456–9.[Abstract/Free Full Text]
  8. Cariolou MA, Kokkofitou A, Manoli P, Christou S, Karagrigoriou A, Middleton L. Underexpression of the apolipoprotein E2 and E4 alleles in the Greek Cypriot population of Cyprus. Genet Epidemiol 1995;12:489–97.[Medline]
  9. Gómez-Coronado D, Alvarez JJ, Entrala A, Olmos JM, Herrera E, Lasunción MA. Apolipoprotein E polymorphism in men and women from a Spanish population: allele frequencies and influence on plasma lipids and apolipoproteins. Atherosclerosis 1999;147:167–76.[Medline]
  10. Schaefer EJ, Lamon-Fava S, Johnson S, et al. Effects of gender and menopausal status on the association of apolipoprotein E phenotype with plasma lipoprotein levels. Results from the Framingham Offspring Study. Arterioscler Thromb 1994;14:1105–13.[Abstract/Free Full Text]
  11. Xhignesse M, Lussier-Cacan S, Sing CF, Kessling AM, Davignon J. Influences of common variants of apolipoprotein E on measures of lipid metabolism in a sample selected for health. Arterioscler Thromb 1991;11:1100–10.[Abstract/Free Full Text]
  12. Corella D, Tucker K, Lahoz C, et al. Alcohol drinking determines the effect of the APOE locus on LDL-cholesterol concentrations in men: the Framingham Offspring Study. Am J Clin Nutr 2001;73:736–45.[Abstract/Free Full Text]
  13. Garcés C, Benavente M, Lasunción MA, Ortega H, Nájera G, de Oya M. Gender-specific effects of apolipoprotein E genotype on plasma lipid levels in a population-based sample of 6–7-year-old children in Spain. Acta Paediatr 2002;91:1039–43.[Medline]
  14. Curtiss LK. ApoE in atherosclerosis: a protein with multiple hats. Arterioscler Thromb Vasc Biol 2000;20:1852–3.[Free Full Text]
  15. Miyata M, Smith JD. Apolipoprotein E allele-specific antioxidant activity and effects on cytotoxicity by oxidative insults and beta-amyloid peptides. Nat Genet 1996;14:55–61.[Medline]
  16. Ramassamy C, Averill D, Beffert U, et al. Oxidative damage and protection by antioxidants in the frontal cortex of Alzheimer's disease is related to the apolipoprotein E genotype. Free Radic Biol Med 1999;27:544–53.[Medline]
  17. Corder EH, Saunders AM, Strittmatter WJ, et al. Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families. Science 1993;261:921–3.[Abstract/Free Full Text]
  18. Peroutka SJ, Dreon DM. The value of genotyping for apolipoprotein E alleles in relation to vitamin E supplementation. Eur J Pharmacol 2000;410:161–3.[Medline]
  19. Gómez-Coronado D, Entrala A, Alvarez JJ, et al. Influence of apolipoprotein E polymorphism on plasma vitamin A and vitamin E levels. Eur J Clin Invest 2002;32:251–8.[Medline]
  20. Ortega H, Coperías JL, Castilla P, Gómez-Coronado D, Lasunción MA. Liquid chromatographic method for the simultaneous determination of different lipid-soluble antioxidants in human plasma and low-density lipoproteins. J Chromatogr B 2004;803:249–55.
  21. Hixson JE, Vernier DT. Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res 1990;31:545–8.[Abstract]
  22. Royo-Bordonada MA, Gorgojo L, Martín-Moreno JM, et al. Spanish children's diet: compliance with nutrient and food intake guidelines. Eur J Clin Nutr 2003;57:930–9.[Medline]
  23. Royo-Bordonada MA, Gorgojo L, de Oya M, et al. Food sources of nutrients in the diet of Spanish children: the Four Provinces Study. Br J Nutr 2003;89:105–14.[Medline]
  24. Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem 1972;18:499–502.[Abstract]
  25. Ferro-Luzzi A, Mobarhan S, Maiani G, Scaccini C, Virgili F, Knuiman JT. Vitamin E status in Italian children subsisting on a Mediterranean diet. Hum Nutr Clin Nutr 1984;38:195–201.[Medline]
  26. Chen LH, Hsu SJ, Huang C, Chen JS. Vitamin E status of Chinese population in Taiwan. Am J Clin Nutr 1977;30:728–35.[Abstract/Free Full Text]
  27. Malvy JM, Mourey MS, Carlier C, et al. Retinol, beta-carotene and alpha-tocopherol status in a French population of healthy children. Int J Vitam Nutr Res 1989;59:29–34.[Medline]
  28. Malvy DJ, Burtschy B, Dostalova L, Amedee-Manesme O. Serum retinol, beta-carotene, alpha-tocopherol and cholesterol in healthy French children. Int J Epidemiol 1993;22:237–46.[Abstract/Free Full Text]
  29. Looker AC, Underwood BA, Wiley J, Fulwood R, Sempos CT. Serum alpha-tocopherol levels of Mexican Americans, Cubans, and Puerto Ricans aged 4–74 y. Am J Clin Nutr 1989;50:491–6.[Abstract/Free Full Text]
  30. Wetherilt H, Ackurt F, Brubacher G, Okan B, Aktas S, Turdu S. Blood vitamin and mineral levels in 7–17 years old Turkish children. Int J Vitam Nutr Res 1992;62:21–9.[Medline]
  31. Strauss RS. Comparison of serum concentrations of alpha-tocopherol and beta-carotene in a cross-sectional sample of obese and nonobese children (NHANES III). National Health and Nutrition Examination Survey. J Pediatr 1999;134:160–5.[Medline]
  32. Lachili B, Faure H, Arnaud J, et al. Blood micronutrients in Algeria, relationships with sex and age. Int J Vitam Nutr Res 2001;71:111–6.[Medline]
  33. Karr M, Mira M, Causer J, et al. Plasma and serum micronutrient concentrations in preschool children. Acta Paediatr 1997;86:677–82.[Medline]
  34. Bendich A. Vitamin E status of US children. J Am Coll Nutr 1992;11:441–4.[Abstract]
  35. Farrell PM, Levine SL, Murphy MD, Adams AJ. Plasma tocopherol levels and tocopherol-lipid relationships in a normal population of children as compared to healthy adults. Am J Clin Nutr 1978;31:1720–6.[Free Full Text]
  36. Thurnham DI, Davies JA, Crump BJ, Situnayake RD, Davis M. The use of different lipids to express serum tocopherol: lipid ratios for the measurement of vitamin E status. Ann Clin Biochem 1986;23(5):514–20.
  37. Looker AC, Johnson CL, Woteki CE, Yetley EA, Underwood BA. Ethnic and racial differences in serum vitamin A levels of children aged 4–11 years. Am J Clin Nutr 1988;47:247–52.[Abstract/Free Full Text]
  38. Lockitch G, Halstead AC, Wadsworth L, Quigley G, Reston L, Jacobson B. Age- and sex-specific pediatric reference intervals and correlations for zinc, copper, selenium, iron, vitamins A and E, and related proteins. Clin Chem 1988;34:1625–8.[Abstract/Free Full Text]
  39. Karr M, Mira M, Causer J, et al. Age-specific reference intervals for plasma vitamins A, E and beta-carotene and for serum zinc, retinol-binding protein and prealbumin for Sydney children aged 9–62 months. Int J Vitam Nutr Res 1997;67:432–6.[Medline]
  40. Sommer A, Davidson FR. Assessment and control of vitamin A deficiency: The Annecy accords. J Nutr 2002;132:2845S–50S.[Abstract/Free Full Text]
  41. Herbeth B, Spyckerelle Y, Deschamps JP. Determinants of plasma retinol, beta-carotene, and alpha-tocopherol during adolescence. Am J Clin Nutr 1991;54:884–9.[Abstract/Free Full Text]
  42. Hebert JR, Hurley TG, Hsieh J, et al. Determinants of plasma vitamins and lipids: the Working Well Study. Am J Epidemiol 1994;140:132–47.[Abstract/Free Full Text]
  43. Willett WC, Stampfer MJ, Underwood BA, Speizer FE, Rosner B, Hennekens CH. Validation of a dietary questionnaire with plasma carotenoid and alpha-tocopherol levels. Am J Clin Nutr 1983;38:631–9.[Abstract/Free Full Text]
  44. Coates RJ, Eley JW, Block G, et al. An evaluation of a food frequency questionnaire for assessing dietary intake of specific carotenoids and vitamin E among low-income black women. Am J Epidemiol 1991;134:658–71.[Abstract/Free Full Text]
  45. Byers T, Trieber F, Gunter E, et al. The accuracy of parental reports of their children's intake of fruits and vegetables: validation of a food frequency questionnaire with serum levels of carotenoids and vitamins C, A, and E. Epidemiology 1993;4:350–5.[Medline]
  46. White E, Kristal AR, Shikany JM, et al. Correlates of serum alpha- and gamma-tocopherol in the Women's Health Initiative. Ann Epidemiol 2001;11:136–44.[Medline]
  47. Stryker WS, Kaplan LA, Stein EA, Stampfer MJ, Sober A, Willett WC. The relation of diet, cigarette smoking, and alcohol consumption to plasma beta-carotene and alpha-tocopherol levels. Am J Epidemiol 1988;127:283–96.[Abstract/Free Full Text]
  48. Ascherio A, Stampfer MJ, Colditz GA, Rimm EB, Litin L, Willett WC. Correlations of vitamin A and E intakes with the plasma concentrations of carotenoids and tocopherols among American men and women. J Nutr 1992;122:1792–801.
  49. Sinha R, Patterson BH, Mangels AR, et al. Determinants of plasma vitamin E in healthy males. Cancer Epidemiol Biomarkers Prev 1993;2:473–9.[Abstract]
  50. Olmedilla B, Granado F, Southon S, et al. Serum concentrations of carotenoids and vitamins A, E, and C in control subjects from five European countries. Br J Nutr 2001;85:227–38.[Medline]
  51. Lehtimaki T, Moilanen T, Viikari J, et al. Apolipoprotein E phenotypes in Finnish youths: a cross-sectional and 6-year follow-up study. J Lipid Res 1990;31:487–95.[Abstract]
  52. Xu CF, Talmud PJ, Angelico F, Del Ben M, Savill J, Humphries SE. Apolipoprotein E polymorphism and plasma lipid, lipoprotein, and apolipoprotein levels in Italian children. Genet Epidemiol 1991;8:389–98.[Medline]
  53. Srinivasan SR, Ehnholm C, Wattigney W, Berenson GS. Apolipoprotein E polymorphism and its association with serum lipoprotein concentrations in black versus white children: the Bogalusa Heart Study. Metabolism 1993;42:381–6.[Medline]
  54. Sanghera DK, Ferrell RE, Aston CE, McAllister AE, Kamboh MI, Kimm SY. Quantitative effects of the apolipoprotein E polymorphism in a biracial sample of 9–10-year-old girls. Atherosclerosis 1996;126:35–42.[Medline]
  55. Traber MG, Burton GW, Ingold KU, Kayden HJ. RRR- and SRR-alpha-tocopherols are secreted without discrimination in human chylomicrons, but RRR-alpha-tocopherol is preferentially secreted in very low density lipoproteins. J Lipid Res 1990;31:675–85.[Abstract]
  56. Parks EJ, Dare D, Frazier KB, et al. Dependence of plasma alpha-tocopherol flux on very low-density triglyceride clearance in humans. Free Radic Biol Med 2000;29:1151–9.[Medline]
  57. Kypreos KE, Li X, van Dijk KW, Havekes LM, Zannis VI. Molecular mechanisms of type III hyperlipoproteinemia: the contribution of the carboxy-terminal domain of apo E can account for the dyslipemia that is associated with E2/E2 phenotype. Biochemistry 2003;42:9841–53.[Medline]
  58. Goulinet S, Chapman MJ. Plasma LDL and HDL subspecies are heterogenous in particle content of tocopherols and oxygenated and hydrocarbon carotenoids. Relevance to oxidative resistance and atherogenesis. Arterioscler Thromb Vasc Biol 1997;17:786–96.[Abstract/Free Full Text]
  59. Wilson PW, Myers RH, Larson MG, Ordovas JM, Wolf PA, Schaefer EJ. Apolipoprotein E alleles, dyslipidemia, and coronary heart disease. The Framingham Offspring Study. JAMA 1994;272:1666–71.[Abstract/Free Full Text]
Received for publication April 1, 2004. Accepted for publication October 21, 2004.




This article has been cited by other articles:


Home page
 Am. J. Clin. Nutr.Home page
J. M Ordovas
Genetic influences on blood lipids and cardiovascular disease risk: tools for primary prevention
Am. J. Clinical Nutrition, May 1, 2009; 89(5): 1509S - 1517S.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
P. Borel, M. Moussa, E. Reboul, B. Lyan, C. Defoort, S. Vincent-Baudry, M. Maillot, M. Gastaldi, M. Darmon, H. Portugal, et al.
Human Plasma Levels of Vitamin E and Carotenoids Are Associated with Genetic Polymorphisms in Genes Involved in Lipid Metabolism
J. Nutr., December 1, 2007; 137(12): 2653 - 2659.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Clin. Nutr.Home page
P. Castilla, R. Echarri, A. Davalos, F. Cerrato, H. Ortega, J. L. Teruel, M. F. Lucas, D. Gomez-Coronado, J. Ortuno, and M. A Lasuncion
Concentrated red grape juice exerts antioxidant, hypolipidemic, and antiinflammatory effects in both hemodialysis patients and healthy subjects
Am. J. Clinical Nutrition, July 1, 2006; 84(1): 252 - 262.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ortega, H.
Right arrow Articles by Lasunción, M. A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ortega, H.
Right arrow Articles by Lasunción, M. A
Agricola
Right arrow Articles by Ortega, H.
Right arrow Articles by Lasunción, M. A

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS