|
|
||||||||
ORIGINAL RESEARCH COMMUNICATION |
- and ß-adrenergic receptor genes are associated with measures of compensatory eating behaviors in young children1,2,31 From the Bute Medical School, University of St Andrews, St Andrews, Scotland (JEC); the Biomedical Research Centre, Ninewells Hospital and Medical School, University of Dundee, Dundee, Scotland (CNAP, BF, and IM); the Chelsea School, University of Brighton, Brighton, United Kingdom (PW); the Department of Human Sciences, Loughborough University, Leicestershire, United Kingdom (DJW); and the Department of Psychology, Glasgow Caledonian University, Glasgow, Scotland (MMH)
2 Supported by grant D13460 from the UK Biotechnology and Biological Sciences Research Council (BBSRC). 3 Address reprint requests to JE Cecil, Bute Medical School, University of St Andrews, St Andrews, Scotland, United Kingdom, KY16 9TS. E-mail: jc{at}100st-andrews.ac.uk.
| ABSTRACT |
|---|
|
|
|---|
(PPARG) and ß-adrenergic receptor (ADRB3) genes have been linked to increased body mass index (BMI; in kg/m2), obesity, and more recently dietary nutrients and preferences. In addition, common variation in ADRB3 interacts with PPARG to modulate adult body weight. Objective: This study investigated whether variants in these genes were associated with measurable effects on child eating behavior.
Design: Children (n = 84) aged 410 y were prospectively selected for variants of the PPARG locus (Pro12Ala, C1431T). Heights and weights were measured. Energy intake from a test meal was measured 90 min after ingestion of a no-energy (NE), low-energy (LE), or high-energy (HE) preload, and the compensation index (COMPX) was calculated.
Results: BMI differed significantly by gene model, whereby Pro12Ala was associated with a lower BMI. Poor COMPX was associated with the PPARG T1431 allele (P = 0.009). There was a significant interaction between COMPX and the ADRB3 Trp64Arg variant in modulating compensation (P = 0.003), whereas the Arg64 allele was associated with good compensation (P = 0.001).
Conclusions: This is the first study to suggest that a genetic interaction involving ADRB3 and PPARG variants influences eating behavior in children.
Key Words: Children eating behavior energy compensation PPARG gene variants BMI body mass index
| INTRODUCTION |
|---|
|
|
|---|
The ability of persons to respond to hunger and satiety cues and to resist external cues to eat is encapsulated by a measure of short-term energy compensation (510). Individual differences in children's ability to regulate energy intake indicate that poor short-term energy regulation is associated with increased child age (6, 8), adiposity (11, 12), and restricted access to energy dense, highly palatable foods (11). These factors explain only part of the variance. Unexplained variation (between individuals) leads us to question the role of gene differences in short-term compensation (1314).
One factor linking adiposity, food response, and appetite is the nuclear fatty acid receptor peroxisome proliferator-activated receptor
(PPAR
) encoded by the PPARG gene (15). PPAR
is expressed in adipose tissue and is a key regulator of adiposity and energy balance. PPAR
is also a target for insulin-sensitizing drugs, known as thiazolidinediones (TZDs) (16). The TZD troglitazone appears to modulate appetite (17) and is mediated in part by PPAR
via regulation of leptin gene transcription (18). Notably, TZD activation of PPAR
results in down-regulation of the leptin gene (19). This association between PPAR
and leptin, a potent adiposity signal with a key role in modulating the central control of ingestive behavior, identifies PPARG as a candidate gene in mediating appetite.
Common variation of the PPARG gene has been linked to body mass index (BMI; in kg/m2) and obesity in whites. The most frequently studied PPARG variant is the praline-to-alanine substitution at codon 12 (Pro12Ala) (20), known to influence body weight regulation (2124). Two additional variants, in linkage disequilibrium with Pro12Ala, are the C1431T variant in exon 6 of PPARG that is linked with susceptibility to cardiovascular disease (25, 26), leptin concentrations (27), and BMI (22, 28, 29) and the C681G1 variant that resides in the PPAR
3 promoter region (30) and is implicated in bone growth (31) and increased height (22, 30). Diet-gene interactions among PPARG Pro12Ala, dietary carbohydrate (32), and fat (3335) also suggest a PPARG role in modulating weight. In addition, the evidence for C1431T in modulating leptin concentrations further implicates PPARG in the control of appetite (27, 36).
This study investigated whether common PPARG gene variants are associated with short-term energy compensation, as a potential behavioral correlate of obesity. We hypothesized that PPARG variants associated with increased weight and BMI would be associated with low (poor) compensation (22). We also assessed the influence of the ß-adrenergic receptor (ADRB) gene on eating, given their close link to PPARG function. ADRB subtypes are candidate obesity genes (37, 38), and ADRB3 and PPARG variants interact to modulate adult body weight (39).
| SUBJECTS AND METHODS |
|---|
|
|
|---|
DNA genotyping
DNA was prepared from mouthwash saliva pellets (40). Allelic discrimination by TaqMan assays was used to determine genotype. The probes and primers used to genotype the PPARG Pro12Ala, C1431T (29), and C681G (22) variants were described previously. The reagents for the genotyping of the ADRB3 Trp64Arg variant were as follows: forward primer, AGGCAACCTGCTGGTCATCGT; reverse primer, CATCACCAGGTCGGCTGCG; T allele probe, 5FAM-CCATCGCCTGGACTCCGAGACTCC-TAMRA; and C allele probe, 5Tet-CCATCGCCCGGACTCCGAGACTCC-TAMRA.
All assays were performed with reagents supplied by Applied Biosystems (Foster City, CA) and with standard amplification conditions. Allelic discrimination was performed on an ABI7700 sequence detection system (Applied Biosystems).
Measurement of height and weight
Height and weight were measured on the morning of the first test condition. Standing height without shoes was measured to the nearest 0.1 cm with the use of a stadiometer (SECA, Bolton, United Kingdom). Body weight, with subjects wearing light clothing, was measured to the nearest 0.5 kg with a mechanical floor scale (SECA). BMI was calculated (2). Overweight and obesity were determined by the use of age- and sex-appropriate international cutoffs (41).
Procedure for measurement of compensation index
The procedure for measurement of compensation index (COMPX) was reported elsewhere (6). This method tests a person's ability to adjust energy intake at a test meal in response to the energy content of preloads. Briefly, children consumed either a no-energy (NE), low-energy (LE), or high-energy (HE) preload midmorning on 3 occasions at school, followed by a test-meal lunch 1.5 h later. The order of preload administration was partially randomized; the NE control preload was consistently administered as the first condition to familiarize children with the procedure and to act as a control condition. Tests were separated by at least 1 wk. Parents were instructed to provide their child with their habitual breakfast on the morning of each test and to record breakfast details.
Preloads and test meals
Three preloads were developed and designed to vary in energy density with minimal differences in sensory properties (6). The NE control (0 kJ) was 250 mL water. The LE preload (187 kcal, or 782.78 kJ) consisted of 250 mL orange drink (200 mL water + 50 mL low-energy orange still soft drink) and 56 g low-energy-dense muffins. The HE preload (389 kcal, or 1628.35 kJ) consisted of 250 mL orange drink (200 mL water + 50 mL low-energy orange still soft drink) with the addition of 15 g maltodextrin (Maxijul; SHS International Ltd, Liverpool, United Kingdom) and 56 g regular-energy-dense muffins. Each child was required to ingest 100% of the preload at each test.
Ninety minutes after preload, children were offered a self-selected test-meal lunch consisting of cold finger food (6). The meal was prepared in quantities in excess of what the children would normally be expected to consume, and the children were invited to eat and drink as much as they wanted. A maximum of 30 min was allotted for the lunch. The average group size on each test occasion was 4, and the children sat together to consume their lunch.
Assessment of food intake
Energy intake at the test meal was assessed by weighing the food items before and after lunch and then using the manufacturers' information to calculate the total amount of energy consumed. The precision of energy compensation was assessed by using the COMPX, which was calculated as the difference in energy intake from the test-meal lunch on any 2 occasions divided by the difference in the energy content of those preloads. The value was converted to a percentage [(change in energy intake at test meal/change between preload energy content) x 100] (11). A score of 100% represents precise (calorie for calorie) compensation. Values <100% reflect undercompensation; values >100% reflect overcompensation. Good COMPX was defined as >50%; poor COMPX was defined as <50%.
Data analyses
Genotype was analyzed with the use of dominant and codominant models, with multiple variants included in the models to test for interactions. Quantitative traits (weight, height, BMI) were analyzed with the use of univariate general linear modeling. Age and sex were included as covariates in all models.
Energy intake and COMPX data were analyzed with the use of repeated measures analyses of variance, with age and sex as between-subject factors. Where significant main effects were obtained, post hoc multiple and pairwise comparisons with a Bonferroni correction factor were applied to determine the nature of the significance.
COMPX and genotype data were analyzed with the use of repeated measures general linear modeling, with genotypes as between-subject factors. Age and sex were used as covariates. Energy intake and genotype data were also analyzed in this way.
All data were analyzed by using SPSS for WINDOWS (version 12.0; SPSS, Chicago, IL). Results for mean COMPX and total energy intake are expressed as means ± SEM unless otherwise stated. Statistical significance was set at P < 0.05
| RESULTS |
|---|
|
|
|---|
|
|
|
Energy intake and COMPX
Analyses of energy intake from the test meal showed a main effect of preload (P < 0.001), which indicated that the children adjusted intake at lunch in response to preload energy content. Energy intake differed significantly by preload (NE: 3005 ± 84 kJ; LE: 2644 ± 78 kJ; HE: 2414 ± 71 kJ; P < 0.001). Total energy intake (energy from the test meal + preload) also differed significantly by preload (P < 0.001), indicating that, despite the adjustment in food intake at lunch after different preloads, this adjustment failed to accommodate precisely the energy content of the preloads. Thus, total energy intake increased by preload (NE: 3090 ± 122 kJ; LE: 3523 ± 113 kJ; HE: 4061 ± 105 kJ; P < 0.001). To determine the precision of energy compensation, COMPX was calculated and analyzed. COMPX scores showed low mean values for all preloads; however, this was subject to wide individual variation (Table 4
). There were no main effects of preload, sex, or age on ability to compensate at the test meal. There was no correlation between COMPX and BMI, but BMI was positively correlated to energy intake for all preloads(NE: r = 0.37, P < 0.001; LE: r = 0.39, P < 0.001; HE: r = 0.32, P < 0.003).
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
The data on overweight and obesity show that the children in this sample were representative of the larger cohort from which they were recruited (2) in terms of the percentage overweight. For obesity, the boys in the current sample had a lower prevalence (2.4%), whereas the girls had a higher prevalence (14.6%) compared with the main cohort (5.0% of boys and 7.2% of girls) (2). We did not measure entry to adiposity rebound but recognize it is a critical window and would advocate measuring this in future studies.
The data from the present study show clearly that PPARG Pro12Ala polymorphism is associated with lower BMI and weight, whereas C681G was significantly associated with greater height. These findings were also present in the larger group from which these subjects were recruited (22). The data indicate that the PPARG Pro12Ala and C681G variants display an opposing interaction in terms of growth phenotype, with the G681 variant associating with accelerated growth and the Pro12Ala variant linked to a deficient energy storage or utilization, leading to reduced growth. The current data also support previous studies in adults indicating that Pro12Ala is associated with protection from an increased BMI (21, 23, 29).
The data on energy compensation have shown that there is large interindividual variation in the ability to compensate at a test-meal lunch for energy ingested earlier in a preload snack. Children adjusted their energy intake in response to preloads in a dose-related manner, but overall the COMPX values showed relatively low values for accuracy for all preloads, indicting that the accuracy of energy compensation observed was poor. The individual variation in COMPX values were not explained by differences in sex or age. We have previously shown that younger children are on average better able to respond appropriately to the different energy contents of snacks given before lunch by adjusting food intake compared with older children (6). Other reports have shown that ability to compensate is also influenced by adiposity and degree of parental influence (11, 12). A major finding in this study was that genotype was a significant factor in ability to compensate. Thus, the COMPX score associated with the genotype of the person. The predominant PPARG single nucleotide polymorphism C1431T was associated with poor energy compensation, and this showed a significant interaction with the Trp64Arg variant of the ß-3 adrenoreceptor. Poor COMPX (<50%) was associated with the presence of a T1431 allele (of C1431T polymorphism), whereas good COMPX (>50%) was associated with the presence of an Arg allele. Previous studies have shown an interaction between ADRB3 and PPARG Pro12Ala variants in modulating adult body weight (38), probably because of linkage with C1431T, and the Trp64Arg variant was associated with carbohydrate preferences (42). Here, we suggest the presence of a genetic interaction between ADRB3 and PPARG variants in modulating energy compensation and a main effect of PPARG C1431T and ADRB3.
Interestingly, the role of PPARG T1431 in COMPX supports its reported association with increased BMI (29) and predisposition to cardiovascular disease (25, 26) in adults. We have also shown that this variant is associated with a small but nonsignificant increase in BMI in prepubertal children (22). In the current data, we showed no association between COMPX and child BMI; however, our children are young and will not yet express fully their PPARG genotype through currently developing phenotype. Thus, poor short-term energy compensation may well constitute a behavioral marker for positive energy balance later in life, as the child develops through adolescence and into adulthood. We have shown that the Pro12Ala variant is associated with lower BMI but is not associated with altered COMPX scores, which would support the notion that this Ala variant is directly associated with lower weight through modulation of energy utilization or storage, and would suggest that the mechanisms controlling eating behavior and weight gain are mediated by different genes or gene variants. In the future, we would want to test short-term COMPX effects on long-term weight gain in a longitudinal design and follow the T1431 carriers who display poor COMPX values at an early age into adulthood to determine their subsequent tendency to gain excess weight. The association of T1431 with poor satiety regulation could be explained in the context of leptin secretion and action, representing a plausible mechanism by which this variant is associated with eating behavior. Indeed the T1431 allele has been shown to be associated with altered leptin concentrations (27, 36); however, we have not measured this factor in the current study. PPARG agonists are known to play a role in regulation of leptin production; eg, TZD activation of PPAR
results in down-regulation of the leptin gene (19). Low leptin concentrations in turn influence a number of neuroendocrine responses that function to conserve energy. Future analyses should include measurement of leptin concentrations to establish the strength of this link.
To date most research into the relation between specific genes and eating behavior has focused on single gene mutations and their role in appetite regulation pathways rather than on complex common gene variants. These single gene mutations, such as the leptin, leptin receptor, and melanocortin 4 receptor genes (4347) are usually rare forms of genes that lead to severe obesity, due in part to a specific disruption or disruptions in the appetite regulatory pathway. So far, little data are available on complex common gene variants and eating behavior traits, but the potential for large interindividual variation in control of food intake that involves gene-gene and gene-environment interactions is likely. This is illustrated by recent data showing that PPARG variants interact with dietary nutrients in modulating body weight, suggesting that differential responses to dietary intake may depend on individual genotype (3335).
The current study included a sample of persons who are largely white (95%). To check the possibility that ethnicity might have influenced the data analyses, we examined the white group (n = 80) separately in terms of allele frequency, genotype by BMI, and genotype and COMPX. The data for the white-only group were indistinguishable from the data presented here. Thus, it is unlikely that ethnic differences contributed significantly to observed gene effects. It is not yet clear how short-term markers of eating behavior predict long-term energy balance and the tendency to gain weight; hence, future follow-up studies would help elucidate our understanding of short-term energy regulation and energy balance in children.
In summary, the data presented here suggest that PPARG Pro12Ala is associated with protection from increased BMI and weight but is not associated with eating behavior specifically in terms of COMPX. PPARG T1431 may have a role in modulating COMPX in a manner concordant to its reported association with increased BMI in adults and children. It is acknowledged that common polymorphisms of the PPARG gene contribute significantly to human body weight, adiposity, and growth, and more recently data indicate that PPARG exerts modulatory effects of diet on body weight. However, this is the first study to report a relation between PPARG variants and energy compensation and supports the proposal that poor short-term energy compensation; hence, inability to regulate food intake may be a behavioral marker for future weight gain.
| ACKNOWLEDGMENTS |
|---|
The author's responsibilities were as followsMMH, CNAP, and PW: obtained funding; JEC, BF, DJW and IM: collected the data; JEC, CNAP, and MMH: analyzed the data; JEC and MMH: wrote the paper. All authors participated in the design and conduct of the experiment and in the data interpretation and writing of this paper. None of the authors had any personal or financial conflict of interest.
| REFERENCES |
|---|
|
|
|---|
gene influences plasma leptin levels in obese humans. Hum Mol Genet 1998;7:43540.
Pro12Ala and C1431T variants reveals opposing associations with body weight. BMC Genet 2002;3:21.[Medline]This article has been cited by other articles:
![]() |
J. M Ordovas Genetic influences on blood lipids and cardiovascular disease risk: tools for primary prevention Am. J. Clinical Nutrition, May 1, 2009; 89(5): 1509S - 1517S. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Cecil, R. Tavendale, P. Watt, M. M. Hetherington, and C. N.A. Palmer An Obesity-Associated FTO Gene Variant and Increased Energy Intake in Children N. Engl. J. Med., December 11, 2008; 359(24): 2558 - 2566. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |