AJCN EB Program 2010 Early Registration
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arredondo, M.
Right arrow Articles by Hertrampf, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arredondo, M.
Right arrow Articles by Hertrampf, E.
Agricola
Right arrow Articles by Arredondo, M.
Right arrow Articles by Hertrampf, E.
American Journal of Clinical Nutrition, Vol. 86, No. 5, 1347-1353, November 2007
© 2007 American Society for Nutrition


ORIGINAL RESEARCH COMMUNICATION

Microsatellite polymorphism in the heme oxygenase-1 gene promoter is associated with iron status in persons with type 2 diabetes mellitus 1,2,3

Miguel Arredondo, Denisse Jorquera, Elena Carrasco, Cecilia Albala and Eva Hertrampf

1 From the Instituto de Nutrición y Tecnología de los Alimentos (INTA) (MA, DJ, EH, and CA) and the Unidad de Diabetes, Departamento de Medicina, Facultad de Medicina Occidente (EC), Universidad de Chile, Santiago, Chile

2 Supported by grant no. 1051006 from the Fondo Nacional de Ciencia y Tecnología of Chile.

3 Reprints not available. Address correspondence to M Arredondo, Laboratorio de Micronutrientes, INTA, El Líbano 5524, Macul, Santiago, Chile. E-mail: marredon{at}inta.cl.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Background: High iron stores are known to cause type 2 diabetes mellitus in persons with hemochromatosis. However, it is not clear whether moderately elevated iron stores predict the risk of type 2 diabetes in healthy persons. Heme oxygenase (HO) 1 expression is increased when intracellular iron increases. Furthermore, HO shows a microsatellite polymorphism in its gene promoter that could be related to its expression and activity.

Objectives: We aimed to determine the length of (GT)n repeats in the HO1 gene promoter by using capillary electrophoresis and HO enzymatic activity in mononuclear cells (MNCs) from adult diabetes patients. We also aimed to assess the relation between these results and iron stores.

Design: We studied 99 patients with type 2 diabetes mellitus and 90 nondiabetic (control) subjects. We determined iron status (serum iron, ferritin, and transferrin receptor), HO activity, and micropolymorphism.

Results: One diabetes patient and 5 control subjects had iron deficiency anemia. No iron overload was detected in either group. Diabetes patients had significantly greater iron stores (P < 0.0001), total body iron (P < 0.001), and HO activity (P < 0.001) than did control subjects. A positive association between serum iron and HO activity was seen in the diabetes patients (P < 0.0001). Allelic frequency did not differ significantly between diabetes patients and control subjects; however, the frequency of the SM genotype was significantly higher and that of the SS and MM genotypes was significantly lower in the diabetes patients than in control subjects (P < 0.001 for all).

Conclusions: Type 2 diabetes patients carrying short (GT)n repeats may have higher ferritin values and greater HO enzymatic activity and may have greater susceptibility to diabetes than may those with long (GT)n repeats.

Key Words: Type 2 diabetes mellitus • iron • heme oxygenase • microsatellite polymorphism


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Susceptibility to type 2 diabetes mellitus is determined by multiple genetic and environmental factors and their interactions (1) Noninsulin-dependent diabetes mellitus is a common complication of iron overload diseases such as hemochromatosis; 53%–80% of persons with hemochromatosis develop diabetes. It has been observed that the development of diabetes in persons with hemochromatosis is related to the magnitude of iron excess (2). However, it is not clear whether moderately elevated iron stores are associated with the risk of type 2 diabetes in healthy persons (3). The mechanisms that determine whether iron promotes the development of diabetes are unknown. A study by Barbieri et al (4) showed in vivo evidence of a relation between hyperinsulinemia or insulin resistance (or both)—the main variables of insulin resistance syndrome—and erythropoiesis. The evidence supporting a role for oxidation in the pathogenesis of diabetes is scant, although some data suggest that free radical formation may play a role by disrupting insulin action and total-body glucose disposal (5). The facts that iron is a powerful prooxidant and that oxidative stress is increased in glucose-intolerant persons suggest possible mechanisms for a role of iron (6-8), and chronically high concentrations of glycemia produce a greater expression of stress genes (ie, HO1, glutathione peroxidase, Zn/Cu-SOD, Mn-SOD, Catalase, HSP70, BCL-2, and NF-kB) than is seen without high concentrations of glycemia. These facts suggest that the expression of stress genes is part of the process by which ß cells adapt to chronic hyperglycemia (9).

Heme oxygenase (HO) is a rate-limiting enzyme in heme degradation, whose action results in the generation of free iron, biliverdin, and carbon monoxide. Biliverdin is subsequently reduced to bilirubin by the enzyme biliverdin reductase. There are 3 HO isoforms; of these, HO-1 is a stress-responsive protein than can be induced by oxidative agents (including iron), heme or hemoglobin, inflammatory mediators, and ultraviolet light (10). Considerable evidence shows that the induction of HO-1 represents an important cytoprotective defense mechanism against oxidative insults in vivo (11). The human HO-1 gene has a (GT)n dinucleotide repeat in the proximal promoter region (12). The (GT)n repeat is the most frequent of the simple repeats scattered throughout the human genome, and many of these exhibit length polymorphism (13) and may negatively affect transcription activity. A (GT)n repeat in the 5'flanking region of the human HO-1 gene is indeed highly polymorphic (14) and may modulate gene transcription in the face of an oxidant challenge (15). Therefore, it could be hypothesized that, if the expression of the HO-1 gene is increased, according to the number of (GT)n repeats, the microsatellite polymorphism may be associated with the development of oxidative stress-induced diseases. Thus, persons with diabetes who had a short polymorphism in the HO-1 gene promoter may have increased HO activity, which in turn could be related to iron metabolism, expressed as an increase in iron stores.

In the present study, we screened allelic frequencies of the (GT)n repeat in the HO-1 gene promoter of Chilean subjects with and without type 2 diabetes mellitus and examined the association among HO enzymatic activity, iron stores, and the length of the (GT)n repeats.


    SUBJECTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Subjects and study design
Ninety-nine persons with type 2 diabetes mellitus who were >45 y old and had experienced ≥2 y of diabetes evolution, as diagnosed and controlled by the Diabetes Program in the Nutrition Unit of Juan de Dios Hospital (Santiago, Chile), and 90 nondiabetic unrelated volunteers with no apparent medical or family history of diabetes and without metabolic syndrome according to Adult Treatment Panel III classification (16) participated in the study. The clinical characteristics of the diabetes patients and control subjects are shown in Table 1Go. A complete review of the medical history of all subjects, including arterial hypertension, body mass index, and waist circumference, was carried out before the beginning of the study.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Physical and biochemical characteristics of diabetes patients and control subjects1

 
Venous blood samples (20 mL) were collected from all subjects after a 48-h low-fat diet and a 12-h overnight fast. Plasmatic biochemical characterization included glycemia, lipid profile (total, LDL, and HDL cholesterol and triacylglycerol), glutamate oxaloacetic acid transaminase (GOT), glutamate pyruvate transaminase (GPT), total bilirubin (TB), alkaline phosphatase (AP), and creatinine. All of these variables were measured enzymatically (DiaLab, Wiener Neudorf, Austria). High-sensitivity C-reactive protein [(hsCRP) Química Clínica Aplicada SA, Amposta, Spain] was assessed to discard inflammatory events. A cutoff of 3 mg/L was used as the upper limit. Hematologic variables included hemoglobin, measured by using a counter (Cell Dyn 1700; Abbott Laboratories, Abbott Park, IL); total serum iron, measured by using graphite furnace atomic absorption spectrometry (Simaa 6100; Perkin-Elmer, Shelton, CT); free erythrocyte protoporphyrin (FEP), measured by using a hematofluorimeter (model 206D; AVIV Biomed, Lakewood, NJ); transferrin receptors (Ramco Laboratories Inc, Houston, TX); and serum ferritin, measured by using an enzyme-linked immunosorbent assay (Dako Corp, Carpinteria, CA). To evaluate iron status, the following cutoffs were used: 120 g/L and 135 g/dL as the lower-normal limit for hemoglobin in women and men, respectively; 70 µg/dL as the upper-normal limit for FEP in red blood cells; and 70 µg/dL as the lower-normal limit for serum iron. Depleted iron stores were defined as serum ferritin concentrations <12 µg/L, iron deficiency without anemia was defined as normal hemoglobin and ≥2 other abnormal laboratory results, and iron deficiency anemia was defined as below-normal hemoglobin and ≥2 other abnormal laboratory results. Iron overload was defined as a serum ferritin concentration > 200 µg/L in women and > 300 µg/L in men (17). Total body iron was calculated from the ratio of transferring receptors to serum ferritin according to the following equation (18):

Formula 1(1)
Written informed consent was obtained from all subjects. The study protocol was approved by the ethics committees of the Instituto de Nutrición de los Alimentos, the University of Chile, and the Nutrition Unit of the Juan de Dios Hospital.

Isolation of mononuclear leukocytes
Mononuclear leukocytes (MNCs) were obtained by following the protocol described by Muñoz et al (19). Briefly, blood was diluted in a 1:1 ratio with sterile phosphate-buffered saline (PBS) (137 mmol NaCl/L, 2.7 mmol KCl/L, 8.1 mmol Na2HPO4/L, and 1.5 mmol KH2PO4/L; pH 7.4), layered onto a Histopaque gradient with a density of 1.119 g/mL (Histopaque 1077; Sigma Diagnostics, St Louis, MO) and centrifuged at 400 x g for 35 min at room temperature. The mononuclear layer (buffy coat) was then removed and washed twice for 10 min in PBS at 180 x g. Immediately afterward, the same wash protocol was performed with RPMI 1640 medium (Invitrogen Life Technology, Carlsbad, CA). Finally, the cells were resuspended in 500 µL PBS.

Genomic DNA and amplification of HO-1 gene
Genomic DNA was obtained from MNCs by using Chomczinsky reagent and quantified at 260 nm (Gene Quant; Pharmacia Biotech, Cambridge, United Kingdom). The amplification of the HO-1 gene promoter was conducted by using polymerase chain reaction with the primers HO-1s cccaaagcttgcagcttc-tcagat-NED and HO-1a gggaaacgaattctggccataggac in a thermal cycler (model #2720; Applied Bio-Systems, Foster City, CA) using 30 cycles of 20 s at 94 °C, 20 s at 60 °C, and 20 s at 72 °C (20, 21). The polymerase chain reaction product (3 µL) was loaded into a 2.5% agarose gel to check the amplification. Finally, capillary electrophoresis was performed to detect the (GT)n length.

Heme oxygenase activity
MNCs (1 x 106) were suspended in 1 mL RPMI-1640 (Invitrogen Life Technology) and 100 µL of 900 µmol H2O2/L and incubated in 5% CO2 for 18 h at 37 °C. Cells were centrifuged for 10 min at 1500 x g at 4 °C, and the resulting pellet was homogenized in 100 µL of nondenaturing lysis buffer (20 mmol KH2PO4/L, 135 mmol KCl/L, and 0.1 mmol EDTA/L; pH 7.4) and centrifuged for 20 min at 10 000 x g at 4 °C. The supernatant (100 µL) was incubated for 1 h at 37 °C in the dark with 100 µL of 15 µmol hemin/L (Sigma-Aldrich), 100 µL of 100 µg biliverdin reductase/mL isolated from rat liver (see the next paragraph), and 600 µL resuspension buffer (100 mmol KH2PO4/L; pH 7.4). The reaction was started with 100 µL of 1 mmol NADPH/L (Sigma-Aldrich). We extracted bilirubin with 1 mL chloroform by stirring it for 1 h and then centrifuging it for 5 min at 200 x g and 4 °C. Bilirubin concentrations were measured at 530 nm (model UV-1601; Shimadzu, Tokyo, Japan). HO activity was expressed as nmol bilirubin·mg protein–1·h–1 (bilirubin molar extinction coefficient: {varepsilon} = 43.5 mmol/L–1 x cm–1) (21-23)

Bilirubin reductase isolation
The livers of rats (Rattus norvegicus) were perfused in situ with saline (0.9% NaCl, pH 7.2) until they reached complete discoloration; then the livers were dissected and homogenized in lysis buffer A (0.1 mol sodium citrate/L; pH 5.0; 10% glycerol) and centrifuged first for 20 min at 10 000 x g at 4 °C and then for 1 h at 105 000 x g at 4 °C. The supernatant was diluted with 20 mmol KH2PO5/L, 135 mmol KCl/L, and 0.1 mmol EDTA/L (pH 7.4). Protein concentrations were determined by BCA assay (BioRad Laboratories, Hercules, CA). The extract was divided into aliquots, which were stored at –20 °C.

Statistical analysis
We used a chi-square test to compare the allelic frequencies and genotypes. A 2-factor repeated-measures analysis of variance was used to evaluate the effect of group (sex x diagnosis) and possible interactions between groups regarding either iron status or the micropolymorphism. Because ferritin concentrations and HO activity had a skewed distribution, their results were retransformed into anti-logarithms to recover the original units and were expressed as geometric means ± SDs. Differences were considered significant at P < 0.05 with the use of STATISTICA for WINDOWS software (release 5.1; Statsoft, Tulsa, OK). Logistic regression techniques (stepwise, forward estimation) were used to assess gene-disease associations after adjustment for confounding variables (STATA software; version 9.2; Statacorp LP, College Station, TX).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
As expected, patients with diabetes mellitus had a greater number of conventional risk factors for cardiovascular events than did the control subjects. The 2 groups did not differ significantly in either age or body mass index (in kg/m2), despite the significant differences in weight and height (P = 0.02 for both) between the 2 groups. There were significant differences in waist circumference, systolic pressure, and diastolic pressure (P < 0.001 for all) between diabetes patients and control subjects, whether analyzed by group or by sex. Liver enzyme activities (ie, GOT, GPT, and AP), cholesterol, HDL, LDL, creatinine, and glycemia also differed significantly between the 2 groups. Although the mean hsCRP did not differ significantly between diabetes patients and control subjects, 51.5% of diabetes patients had values higher than 3 mg/L, whereas only 31.4% of control subjects did so.

Only 1 of the diabetes patients had iron deficiency anemia. However, of the 90 control subjects, 6 had depleted iron stores and 5 had iron deficiency anemia. Mean hemoglobin concentrations did not differ significantly between control subjects and diabetes patients. Furthermore, mean total serum iron was significantly (P < 0.05) higher in subjects with diabetes than in control subjects. No subjects in either group had iron overload. Serum ferritin was significantly higher in diabetes patients than in control subjects (53.8 and 38.8 µg/L, respectively; P < 0.001). Furthermore, 63 of the diabetes patients and 30 of the control subjects had serum ferritin concentrations > 50 µg/L. On the other hand, only 6 of the diabetes patients had concentrations > 100 µg/L, and none had concentrations > 200 µg/L. None of the control subjects had serum ferritin concentrations > 100 µg/L. Transferrin receptor values were significantly lower in diabetes patients than in control subjects (5.5 and 6.8 µg/mL, respectively; P < 0.001). Finally, the total-body iron calculation showed that diabetes patients had significantly more body iron than did control subjects (7.0 and 5.0 mg/kg, respectively; P < 0.001) (Table 2Go).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Hematologic characteristics of the total population1

 
The HO activity in MNCs was significantly higher in subjects with diabetes than in control subjects [0.22 (0.07–0.66) and 0.71 (0.23–2.18) nmol bilirubin·mg protein–1·h–1, respectively; P < 0.001] (Table 2Go). There was a positive association between serum iron and serum ferritin in both control subjects (r2 = 0.57) and diabetes patients (r2 = 0.47) (Figure 1Go). The subjects with diabetes had a more positive relation between serum iron and HO activity (r2 = 0.53) than did the control subjects (r2 = 0.01) (Figure 1Go).


Figure 1
View larger version (18K):
[in this window]
[in a new window]

 
FIGURE 1.. Top) Relation between serum iron and serum ferritin in diabetes patients (right) and control subjects (left). Serum iron (mg/dL) was measured by using graphite furnace atomic absorption spectrometry, and serum ferritin (µg/L) was measured with an enzyme-linked immunosorbent assay. Bottom) Relation between serum iron and hemo oxygenase (HO) activity in diabetes patients (right) and control subjects (left). Serum iron was measured as described above, and HO activity was measured (nmol bilirubin·mg protein–1·h–1) in mononuclear leukocytes. n = 99 diabetes patients and 90 control subjects.

 
The distribution of (GT)n repeats in the HO1 gene was trimodal; it ranged between 16 and 40 (GT)n repeats. We divided the alleles into 3 subclasses, according to the number of (GT)n repeats: the lower component (S) with ≤ 26 GT repeats, the middle components (M) with GT repeats between 27 and 32, and the upper components (L) with ≥ 33 GT repeats. The most frequently distributed numbers of (GT)n were (GT)19/(GT)26 and (GT)21/(GT)28 in subjects with diabetes and control subjects, respectively. When the proportions of allele frequency (S, M, and L) (Table 3Go) and genotypes (SS, SM, SL, MM, ML, and LL) (Table 4Go) were analyzed, the distribution of allelic frequency did not differ significantly between the diabetes patients and the control subjects. However, the proportion of allelic frequencies of the S and M classes were significantly higher than that of the L class in both groups. In contrast, the genotypes differed significantly (P < 0.001; chi-square test: 75.187) between diabetes patients and control subjects, and particularly so between the SS, SM, and MM genotypes.


View this table:
[in this window]
[in a new window]

 
TABLE 3. Allele frequencies at the polymorphic locus1

 

View this table:
[in this window]
[in a new window]

 
TABLE 4. Distribution of genotypes1

 
We next examined the relation between HO activity and genotype [2-factor analysis of variance: genotype, P < 0.01; group (diabetic or control), P < 0.02; interaction, NS]. The higher activity was associated with SM, SL, and MM genotypes in diabetes patients. HO activity [geometric Formula 1 (range ± SE)] in these genotypes was 0.79 (0.26–2.44), 0.85 (0.36–2.00), and 0.56 (0.21–1.50) nmol bilirubin·mg protein–1·h–1, respectively, compared with 0.27 (0.08–0.92), 0.14 (0.06–0.33), and 0.15 (0.06–0.40) nmol bilirubin·mg protein–1·h–1, respectively, in the control group (P < 0.01, t test between diabetes patients and control subjects) (Figure 2Go). Logistic regression analysis to adjust the association between HO1 polymorphism and diabetes for other possible contributing variables, such as serum iron, ferritin, and HO activity, showed a significant association between serum ferritin and HO enzymatic activity in patients with diabetes (Table 5Go).


Figure 2
View larger version (8K):
[in this window]
[in a new window]

 
FIGURE 2.. Relation between heme oxygenase (HO) activity and genotype in persons with (right; n = 99) or without (left; n = 90) diabetes mellitus. - - -, the 95th percentile of the control value of HO activity. The relation was significant, P < 0.01 (2-factor ANOVA).

 

View this table:
[in this window]
[in a new window]

 
TABLE 5. Logistic regression for diabetes patients as outcome and serum iron, ferritin, and heme oxygenase (HO) enzymatic activity as contributing variables (with control by age)

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the present study, we found an association between increased SM genotype frequency and increased activity of HO1 in diabetes patients than in the control subjects. The diabetes patients presented with higher iron stores than did the control subjects, although all subjects had normal iron stores. Because control subjects do not show high values of HO activity or serum iron and ferritin, we cannot rule out the possibility that persons without diabetes but with high serum iron or ferritin could present with high HO activity.

Iron stores usually are quantified by the measurement of transferrin receptors and serum ferritin concentrations. However, although serum ferritin is considered a good indicator of body iron stores, it is not the gold standard. Given that serum ferritin is an acute phase protein and may reflect inflammatory activity, its concentration can be overestimated during an inflammatory process (24). Jiang et al (3) showed that women with elevated ferritin concentrations and a lower ratio of transferrin receptor to ferritin had a greater risk of diabetes, which was independent of known diabetes risk factors and of inflammation as measured by C-reactive protein, than did women with low ferritin concentrations and a high ratio of transferring receptor to ferritin. The population in the present study had signs of inflammatory processes. To refine the evaluation of iron stores, we measured transferrin receptors, which enabled us to calculate the ratio of transferrin receptor to ferritin as a means of estimating iron stores. These measurements differed significantly between the 2 groups, which showed that the diabetes patients had more total body iron than did the control subjects.

Our data support the theory that high iron stores, even in a range not considered to be associated with hemochromatosis, contribute to the development of insulin-nondependent diabetes. Furthermore, the diabetes patients had higher concentrations of serum iron and ferritin and greater HO activity than did the control subjects. The association between serum ferritin and diabetes was described previously (3, 24-26); in one of those studies, men with high stores of iron were 2.4 times as likely to develop diabetes than were men with lower stores of iron, as assessed by using a logistic regression model (25). Similarly, the results of the present study confirm that even a modest elevation in the ferritin concentration predicts incident diabetes independently of known risk factors and confounders (27).

We show that the poly-(GT) sequence present in the HO1 gene promoter is highly polymorphic in the population in the present study. The (GT)n repeat is located between the putative heat-shock element and the cis-regulatory element (28). A specific allele for this polymorphism may affect the transcription of the HO1 gene. Greater expression of the HO1 gene may not be beneficial for the host, given the potential cell toxicity of the heme degradation product (ie, iron). There is extensive literature about the role of iron in the production of oxidative stress, and some studies showed that increased oxidative stress in diabetic rats leads to the induction of HO1 (29, 30). It was suggested that the 5'flanking polymorphism in the HO1 gene is associated with the development of oxidative stress–mediated diseases, in which subjects possessing S/S had higher expression of HO1 mRNA and HO activities than did those without S/S (21). These results are very similar to those reported here—ie, the diabetes patients have higher expression of SS and SM HO1 polymorphism and higher HO activities than do the controls subjects. Therefore, it is particularly important that HO1 gene expression be properly regulated in humans.

Most HO1 polymorphism studies had been performed in Asian populations (14, 15, 20). These studies showed a higher frequency of S (46%) and M (44%) alleles in control subjects than in diabetes patients (15) or similar proportions of the M allele in control subjects (77%) and diabetes patients (81%) (20). The results in the present study showed no difference in allel frequencies between control subjects and diabetes patients (Table 3Go). Chen et al (20) showed a similar frequency of HO1 promoter genotypes between control subjects and subjects with diabetes; however, we observed a marked difference between the 2 groups, especially with respect to SS, SM, and MM HO1 promoter genotypes (Table 4Go). It is necessary to remark that HO activity in control subjects with the SM polymorphism also could be influenced by serum iron and ferritin. However, in the present study, subjects with these characteristics were not represented. Furthermore, a logistic regression analysis showed that the results of the present study confirm that diabetes patients with the SM polymorphism have a higher relative risk ratio when presenting with high ferritin concentrations and high HO activity than do those patients without the SM polymorphism.

In summary, our results show an association between iron metabolism and type 2 diabetes mellitus, even in the normal ranges of iron status variables. Iron is a first-line prooxidant element that contributes to the development of several systemic diseases, including diabetes and atherosclerosis. Thus, higher concentrations of iron could determine an amplification of the oxidative stress produced by free radicals. The participation of iron in oxidative stress could explain in part the association of iron to abnormalities regarding insulin sensibility.


    ACKNOWLEDGMENTS
 
We thank the staff of the Diabetes Program, Nutrition Unit, Juan de Dios Hospital, for their teamwork and persistent efforts in this project.

The authors' responsibilities were as follows—MA: study design; management of laboratory work, data collection, analysis, and interpretation; and writing of the manuscript; DJ: laboratory analysis, data collection, and analysis and interpretation; EH: study design, management of hemachromatosis patients, and revision of the manuscript; EC: management of the field site, sample collection, and revision of the manuscript; and CA: study design, management of diabetes patients, and revision of the manuscript. None of the authors had a personal or financial conflict of interest.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Avery C, Freedman BI, Kraja AT, et al. KE. Genotype-by-sex interaction in the etiology of type 2 diabetes mellitus: support for sex-specific quantitative trait loci in Hypertension Genetic Epidemiology Network. Diabetologia 2006;49:2329–36.[Medline]
  2. Witte D, Crosby WH, Edwards CQ, Fairbanks VF, Mitros FA. Practice Guideline Development Task Force of the College of American Pathologists: hereditary hemochromatosis. Clin Chim Acta 1996;45:139–200.
  3. Jiang R, Manson JE, Meigs JB, Ma J, Rifai N, Hu F. Body iron store in relation to risk of type-2 diabetes in apparently healthy women. JAMA 2004;291:711–7.[Abstract/Free Full Text]
  4. Barbieri M, Ragno E, Benvenutti E. New aspects of the insuline resistance syndrome: impact on hematological parameters. Diabetologia 2001;44:1232–7.[Medline]
  5. Paolisso G, D'Amore A, Gugliano D, Ceriello A, Varrichio M, D'Onofrio F. Pharmacologic doses of vitamin E improve insulin action in healthy subjects and noninsulin-dependent diabetic patients. Am J Clin Nutr 1993;57:650–6.[Abstract/Free Full Text]
  6. Dandona P, Thusu K, Cook S. Oxidative damage to DNA in diabetes mellitus. Lancet 1996;347:444–5.[Medline]
  7. Giugliano D, Ceriello A, Paolisso G. Oxidative stress and diabetic vascular complications. Diabetes Care 1996;19:257–67.[Abstract]
  8. Gopaul N, Anggard EE, Mallet AI, Betteridge DJ, Wolff SP, Nourooz-Zadeh J. Plasma 8-epi-PGF2 alpha levels are elevated in individuals with non-insulin dependent diabetes mellitus. FEBS Lett 1995;368:225–9.[Medline]
  9. Laybutt D, Kaneto H, Hasenkamp W, Grey S. Increased expression of antioxidant and antiapoptotic genes in islets that may contribute to b-cell survival during chronic hyperglycemia. Diabetes 2002;51:413–23.[Abstract/Free Full Text]
  10. Abraham N, Drummond GS, Lutton JD, Kappas A. The biological significance and physiological role of heme oxygenase. Cell Physiol Biochem 1996;6:129–68.
  11. Maines M. Heme oxygenase: function, multiplicity, regulatory, mechanisms, and clinical applications. FASEB J 1998;2:2557–68.
  12. Lavrovsky Y, Schwartzman C, Levere RD, Kappas A, Abraham NG. Identification of binding sites for transcription factors NF-kB and AP-2 in the promotor region of the human heme oxygenase-1 gene. Proc Natl Acad Sci U S A 1994;91:5987–91.[Abstract/Free Full Text]
  13. Naylor LH, Clark EM. d(TG)n. d(CA)n sequences upstream of the rat prolactin gene form Z-DNA and inhibit gene transcription. Nucleic Acid Res 1990;8:1595–601.
  14. Kimpara T, Takeda A, Watanabe K. Microsatellite polymorphism in the human heme oxygenase-1 gene promoter and its application in association studies with Alzheimer and Parkinson disease. Hum Genet 1997;100:145–7.[Medline]
  15. Yamada N, Yamaya M, Okinaga S, Nakayama K. Microsatellite polymorphism in the heme oxygenase-1 gene promoter is associated with susceptibility to emphysema. Am J Hum Genet 2000;66:187–95.[Medline]
  16. Grundy S, Cleeman JI, Bairey-Merz N, et al. Implications of recent clinical trials for the National Cholesterol Education Program Adult Treatment Panel III guidelines. Circulation 2004;110:227–39.[Abstract/Free Full Text]
  17. Adams P, Reboussin DM, Barton JC, et al. Hemochromatosis and iron-overload screening in a racially diverse population. N Engl J Med 2005;352:1769–78.[Abstract/Free Full Text]
  18. Cook J, Flowers CH, Skikne BS. The quantitative assessment of body iron. Blood 2003;101:3359–63.[Abstract/Free Full Text]
  19. Munoz C, Lopez M, Olivares M, Pizarro F, Arredondo M, Araya M. Differential response of interleukin-2 production to chronic copper supplementation in healthy humans. Eur Cytokine Netw 2005;16:261–5.[Medline]
  20. Chen Y, Lin S, Lin M, et al. Microsatellite polymorphism in promoter of heme oxygenase-1 gene is associated with susceptibility to coronary artery disease in type 2 diabetic patients. Hum Genet 2000;111:1–8.
  21. Hirai H, Kubo H, Yamaya M, et al. Microsatellite polymorphism in heme oxygenase-1 gene promoter is associated with susceptibility to oxidant-induced apoptosis in lymphoblastoid cell lines. Blood 2003;102:1619–21.[Abstract/Free Full Text]
  22. Kutty R, Maines M. Purification and characterization of biliverdin reductase from rat liver. J Biol Chem 1981;256:3956–62.[Abstract/Free Full Text]
  23. Mcnally S, Ross J, Garden O, Wigmore S. Optimization of the paired enzyme assay for heme oxygenase activity. Anal Biochem 2004;32:398–400.
  24. Ford E, Cogswell ME. Diabetes and serum ferritin concentration among U.S. adults. Diabetes Care 1999;22:1978–83.[Abstract/Free Full Text]
  25. Salonen J, Tuomainen TP, Nyyssonen K, Lakka HM, Punnonen K. Relation between iron stores and non-insulin-dependent diabetes in men: case-control study. BMJ 1998;317:727–30.[Free Full Text]
  26. Fleming D, Jacques PF, Tucker KL, Massaro JM. Iron status of the free-living, elderly Framingahm heart study cohort: an iron-replete population with a high prevalence of elevated iron status. Am J Clin Nutr 2001;73:638–46.[Abstract/Free Full Text]
  27. Forouhi NG, Harding AH, Allison M, et al. Elevated serum ferritin levels predict new-onset type 2 diabetes: results from the EPIC-Norfolk prospective study. Diabetologia 2007;50:949–56.[Medline]
  28. Okinaga S, Takahashi K, Takeda K, et al. Regulation of human heme oxygenase-1 gene expression under thermal stress. Blood 1996;87:5074–84.[Abstract/Free Full Text]
  29. Hayashi K, Haneda M, Koya D, Maeda S, Issiki K, Kikkawa R. Enhancement of glomerular heme oxygenase-1 expression in diabetics rats. Diabetes Res Clin Pract 2001;52:85–96.[Medline]
  30. Cosso L, Maineri EP, Traverso N, et al. Induction of heme oxygenase 1 in liver of spontaneously diabetic rats. Free Radic Res 2001;34:189–91.[Medline]
Received for publication March 15, 2007. Accepted for publication July 11, 2007.




This article has been cited by other articles:


Home page
Am J EpidemiolHome page
F. Song, X. Li, M. Zhang, P. Yao, N. Yang, X. Sun, F. B. Hu, and L. Liu
Association Between Heme Oxygenase-1 Gene Promoter Polymorphisms and Type 2 Diabetes in a Chinese Population
Am. J. Epidemiol., September 15, 2009; 170(6): 747 - 756.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
N. K. Idriss, A. D. Blann, and G. Y.H. Lip
Hemoxygenase-1 in Cardiovascular Disease
J. Am. Coll. Cardiol., September 16, 2008; 52(12): 971 - 978.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arredondo, M.
Right arrow Articles by Hertrampf, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arredondo, M.
Right arrow Articles by Hertrampf, E.
Agricola
Right arrow Articles by Arredondo, M.
Right arrow Articles by Hertrampf, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS