AJCN Tufts Nutrition Symposium, Boston & Online Sept 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hopkinson, N. S
Right arrow Articles by Polkey, M. I
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hopkinson, N. S
Right arrow Articles by Polkey, M. I
Agricola
Right arrow Articles by Hopkinson, N. S
Right arrow Articles by Polkey, M. I
American Journal of Clinical Nutrition, Vol. 87, No. 2, 385-390, February 2008
© 2008 American Society for Nutrition


ORIGINAL RESEARCH COMMUNICATION

Vitamin D receptor genotypes influence quadriceps strength in chronic obstructive pulmonary disease1,2,3

Nicholas S Hopkinson, Ka Wah Li, Anthony Kehoe, Steve E Humphries, Michael Roughton, John Moxham, Hugh Montgomery and Michael I Polkey

1 From the Respiratory Muscle Laboratory, Royal Brompton Hospital, London, United Kingdom (NSH and MIP); the Centre for Cardiovascular Genetics, Royal Free and UCL Medical School, Rayne Institute, London, United Kingdom (KWL and SEH); the UCL Institute for Human Health and Performance, London, United Kingdom (AK and HM); the National Heart and Lung Institute, Imperial College, London, United Kingdom (NSH, MR, and MIP); and the Department of Respiratory Medicine, King's College Hospital, London, United Kingdom (JM)

2 Supported by The Wellcome Trust (to NSH), by grant no. QLK6-CT-2002-02285 from the European Union (to MIP), and by grant no. PG2005/014 from the British Heart Foundation (to KWL and SHE).

3 Reprints not available. Address correspondence to NS Hopkinson, Royal Brompton Hospital, Fulham Road, London, SW3 6NP United Kingdom. E-mail: n.hopkinson{at}ic.ac.uk.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Background: Quadriceps weakness is an important complication of chronic obstructive pulmonary disease (COPD) and is associated with impaired exercise capacity and greater mortality. Its etiology is multifactorial, and evidence is growing that it is partly determined by genetic susceptibility.

Objective: Using an established cohort, we tested whether quadriceps weakness in patients with COPD is influenced by common variations in the gene for the vitamin D receptor.

Design: Vitamin D receptor FokI and BsmI genotypes and the (I/D) angiotensin-converting enzyme (ACE) and bradykinin receptor (+9/–9) genotypes were identified in 107 patients with stable COPD [x ± SD forced expiratory volume in 1 s (FEV1): 34.5 ± 16.5] and 104 healthy, age-matched control subjects. Quadriceps maximum voluntary contraction force and fat-free mass assessed by bioelectrical impedance analysis were measured.

Results: After adjustment for covariables, both patients and control subjects who were homozygous for the C allele of the FokI polymorphism had less quadriceps strength than did those with ≥1 T allele [41.0 ± 11.8 compared with 46.0 ± 13.2 kg (P = 0.01) and 32.5 ± 11.2 compared with 36.2 ± 13.1 kg (P = 0.005), respectively]. The b allele of the BsmI polymorphism was associated with greater quadriceps strength in patients—37.0 ± 13.3, 33.8 ± 11.6, and 33.8 ± 11.6 kg for bb, bB, and BB, respectively (P = 0.0005)—but had no effect in healthy control subjects. The effect of BsmI on quadriceps strength was least apparent in patients with the ACE II genotype (P = 0.003).

Conclusions: The FokI common variants in the VDR gene are associated with skeletal muscle strength in both patients and control subjects, whereas the BsmI polymorphism is associated with strength only in patients.

Key Words: Muscle • quadriceps • angiotensin-converting enzyme • bradykinin


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Quadriceps weakness is an important systemic consequence of chronic obstructive pulmonary disease (COPD) and is associated with a decreased exercise capacity (1-4). Moreover, reduced quadriceps bulk (5) and strength (6) are associated with greater mortality. Several etiologic factors have been proposed, including disuse atrophy, systemic inflammation, hormonal dysfunction, and systemic corticosteroid treatment (7).

Twin studies have shown that there is a significant genetic component to muscle strength (8, 9). A study of lower-limb strength in elderly male twins found that genetic factors appeared to be more significant in the poorest quartile of performance, and environmental factors appeared more significant as determinants of good performance (9). It seems reasonable to assume that susceptibility to the systemic effects of COPD should to some extent be genetically determined. In support of this, we have shown associations between quadriceps strength and both the I/D polymorphism of the angiotensin-converting enzyme (ACE) and the + 9/–9 polymorphism of the bradykinin receptor (BK2R) in patients with COPD (10, 11). Vitamin D has a well-described role in calcium metabolism, increasing the absorption of calcium and phosphate from the intestine and increasing renal calcium reabsorption. It has been suggested that vitamin D also may have an important role in influencing skeletal muscle function (12), and vitamin D receptors have been identified in this tissue (13).

Several VDR polymorphisms exist that are associated with a range of biological effects on variables, including bone mineral density, immune response, and susceptibility to a range of diseases such as osteoarthritis, diabetes, cancer, cardiovascular disease, and tuberculosis (14). FokI, a polymorphism involving a T->C transition in exon 2 of the VDR gene, changes the site at which translation is initiated. Persons with the C allele (sometimes designated "F") have a shorter 424-amino acid VDR than do persons with the T ("f") allele, which is 427 amino acids long. The shorter VDR appears to have enhanced transactivation capacity as a transcription factor (15-17). The C allele of FokI has been associated with reduced fat-free mass (FFM) and quadriceps strength in otherwise healthy elderly men (18).

BsmI is a restriction fragment length polymorphism at the 3' end of the VDR gene that has also been found to be associated with skeletal muscle function. The b (rather than B) allele was associated with lower FFM and hamstring (but not quadriceps) strength in healthy young women aged 20–39 y (19), whereas, in nonobese elderly women, both handgrip and quadriceps strength were higher in those with the bb genotype (20).

Given the association of impaired skeletal muscle function with COPD, and the association of VDR genotype with muscle function in other population samples, we sought a similar association of VDR FokI and BsmI genotypes with muscle strength in a group of COPD patients and age-matched healthy subjects in whom the association of ACE and BK2R genotypes with strength was shown previously (10, 11).


    SUBJECTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Subjects
Data from this group of subjects were published previously (10, 11). Briefly, patients with COPD, defined in accordance with the criteria of the Global Initiative for Chronic Obstructive Pulmonary Disease (Internet: www.goldcopd.com), were recruited from hospital clinics. Subjects with significant comorbidity including heart failure, diabetes, malignancy, and neuromuscular disease were excluded. Healthy age-matched control subjects were recruited by advertisement in local newspapers.

All participants provided written informed consent. The study was approved by the Ethics Committee of The Royal Brompton and Harefield NHS Trust.

Methods
FFM was measured by using a bioelectrical impedance device (Bodystat 1500; Bodystat, Douglas, United Kingdom). For patients, a disease-specific regression equation was used (21), and, for healthy subjects, the device's internal algorithm was used. Pulmonary function (gas transfer, plethysmographic lung volumes and spirometry in patients, and spirometry only in controls) was assessed by using a CompactLab system (Jaeger, Würzburg, Germany). Quadriceps strength, calculated as quadriceps maximum voluntary contraction force (QMVC), was measured while subjects were seated in a custom-designed chair with their legs bent at the knees to 90 degrees. An inextensible strap connected the subject's ankle to a strain gauge. The signal was amplified and passed to a computer running LABVIEW software (version 4.1; National Instruments, Austin, TX). The force generated was visible online, and subjects received vigorous encouragement. The best of ≥3 efforts was taken.

In control subjects, handgrip strength also was measured by using a Jamar handgrip dynamometer (Sammons Preston Rolyan, Bolingbrook, IL). Subjects performed 6 maximum contractions ≥30 s apart, alternating hands. The mean of the peak value for each hand was recorded.

Genotyping
VDR FokI genotypes (rs 10735810) were identified by using the forward primer 5' GGCCTGCTTGCTGTTCTTAC 3' and reverse primer 5' TGCTTCTTCTCCCTCCCTTT 3'. VDR BsmI genotypes (rs 1544410) were identified by using the forward primer 5' CCTCACTGCCCTTAGCTCTG 3' and reverse primer 5' CCATCTCTCAGGCTCCAAAG 3'. Polymerase chain reaction (PCR) was performed by using a thermal cycler (PTC-225; MJ Research, Watertown, MA), and digestion products were run on 7.5% polyacrylamide gels. All genotypes were scored by 2 independent technicians (blinded as to subject status), and any discrepancies were resolved by repeat genotyping. ACE I/D and BK2R + 9/–9 genotypes were identified as reported previously (10, 11).

Statistical analysis
Analyses were performed with STATVIEW software (version 5.0; Abacus Concepts Inc, Berkeley, CA); they focused on the effect of the VDR genotype on QMVC. A hierarchy of models was analyzed in all subjects including potential confounders [ie, age, sex, FFM, and forced expiratory volume in 1 s (FEV1)] and a term to test for differences between patients and control subjects and also including the various genotypes to test for significant interactions. Interactions between the VDR genotype and ACE and BK2R genotype were also sought. An effect of the ACE genotype was considered across all 3 genotypes. For the BK2R genotype, a binary approach comparing +9 homozygotes to the other 2 genotypes was used (10, 11). For FokI, C homozygotes were compared with the other 2 genotypes, whereas BsmI was analyzed across all 3 genotypes, as is consistent with previous studies (18, 20). In the COPD population, gas transfer [carbon monoxide transfer factor (TLCO)] was used instead of FEV1 as an index of disease severity, because it is known that muscle wasting in COPD patients is correlated with the degree of emphysema more strongly than is the severity of airflow limitation (22, 23). Continuous variables are expressed as means ± SDs. P < 0.05 was taken as statistically significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Data were available for 104 healthy control subjects and 107 COPD patients. BsmI genotyping failed in 1 patient. COPD patients had a significantly (P < 0.05) lower FFM index and QMVC than did controls (Table 1Go). The allele frequencies of the VDR, ACE and BK2R polymorphisms did not differ significantly between patients and control subjects, and the distribution of genotypes was as expected for Hardy-Weinberg proportions. There was no evidence of linkage disequilibrium between FokI and BsmI polymorphisms (D', –0.03; R2, <0.005; P = 0.6).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Characteristics of study subjects1

 
FokI genotype
In the entire sample, FokI C-homozygous subjects had significantly weaker quadriceps than did subjects with 1 or 2 T alleles: 36.5 ± 12.2 kg compared with 41.2 ± 14.0 kg (P = 0.01, Scheffe test) (Figure 1Go). This difference became more significant (P = 0.0002) in a model that included age, sex, FFM, FEV1, and ACE genotypes. There was no evidence that being a patient or a control subject affected the relation between FokI genotype and QMVC. In the control group, there was a trend for C homozygotes to have a lower QMVC than did those with ≥1 T allele: 41.0 ± 11.8 kg compared with 46.0 ± 13.2 kg (P = 0.052, Scheffe test). This difference became significant (P = 0.007) in a model including age, FFM, FEV1, sex, and ACE genotype.


Figure 1
View larger version (4K):
[in this window]
[in a new window]

 
FIGURE 1.. Mean (±SEM) influence of the FokI allele of the vitamin D receptor (VDR) on quadriceps strength [quadriceps maximal voluntary contraction force (QMVC)] in patients with chronic obstructive pulmonary disease and control subjects. Patients ({blacksquare}; n = 107) were significantly weaker than control subjects (•; n = 104) (P < 0.0001, unpaired t test). In both groups, after correction for covariables, homozygosity for the C allele of the FokI VDR polymorphism was associated with lower QMVC than was seen in subjects with the other genotypes. *P = 0.005, {dagger}P = 0.007 (ANOVA). The effect of FokI polymorphism on QMVC did not differ significantly between patients and control subjects.

 
In the COPD group, C homozygotes had significantly lower QMVC than did those with ≥1 T allele: 32.5 ± 11.2 kg compared with 36.2 ± 13.1 kg (P = 0.02). Univariate analysis in the COPD patient group showed a relation between QMVC and FFM (R = 0.62, P < 0.001), TLco (% of predicted) (R = 0.23, P = 0.02), and age (R = 0.18, P = 0.06) but not with FEV1 (% of predicted) or arterial blood gas variables. If TLCO (% of predicted) was used as a measure of disease severity instead of FEV1 in the model above, the effect of C homozygosity on QMVC became even more significant (P = 0.005). No evidence of an interaction between C homozygosity on QMVC and other polymorphisms was found either in an analysis of the whole population or in separate analyses of patients and control subjects.

BsmI genotype
In the whole population studied, there was a trend for the b allele of the BsmI polymorphism to be associated with greater QMVC (P = 0.09 for linear trend) (Figure 2Go). In the entire population, the effect of patient group x genotype interaction for QMVC was not significant (P = 0.38). In control subjects alone, there was no significant relation with QMVC. A highly significant association (P = 0.0005) existed between BsmI genotype and QMVC in COPD patients in a model including cofactors and the other genotypes studied (Table 2Go and Table 3Go). This model including FFM, age, VDR allele C homozygosity, and ACE genotype explained 45% of the variation in QMVC. QMVC values were 37.0 ± 13.3, 33.8 ± 11.6, and 32.6 ± 12.7 kg for patients with the bb, bB, and BB BsmI genotypes, respectively. The ACE genotype x effect of BsmI interaction for QMVC was significant (P = 0.003); BsmI had the least effect in patients with the ACE II genotype. BK2R genotype did not interact significantly with either VDR variant studied.


Figure 2
View larger version (4K):
[in this window]
[in a new window]

 
FIGURE 2.. Mean (±SEM) influence of the BsmI allele of the vitamin D receptor (VDR) on quadriceps strength [quadriceps maximal voluntary contraction force (QMVC)] in patients with chronic obstructive pulmonary disease and control subjects. Patients ({blacksquare}; n = 106) were significantly weaker than control subjects (•; n = 104) (P < 0.0001, unpaired t test). In patients, QMVC varied significantly according to the BsmI allele [*P = 0.0005 (ANOVA)] in a model containing fat-free mass, age, sex, angiotensin-converting enzyme genotype, and C homozygosity for the FokI genotype. No significant relation between genotype and QMVC existed in control subjects.

 

View this table:
[in this window]
[in a new window]

 
TABLE 2. Characteristics of chronic obstructive pulmonary disease patients by BsmI genotype1

 

View this table:
[in this window]
[in a new window]

 
TABLE 3. Regression table for quadriceps strength in chronic obstructive pulmonary disease patients1

 
The associations between the polymorphisms studied and quadriceps strength did not differ by sex. Corticosteroid exposure, expressed as the average daily dose of prednisone received in the preceding year [mostly administered as short burst courses for acute exacerbations; 13 patients were taking long-term low-dose (ie, <10 mg prednisone/d) steroids], was not associated with quadriceps strength by univariate analysis and did not influence the gene x strength interaction in multivariate analysis.

Handgrip strength was measured only in the control subjects. It was significantly lower in FokI C homozygotes than in those with ≥1 T allele—33.2 ± 8.1 kg compared with 36.9 ± 9.2 kg (P < 0.001)— in a model including FFM, sex, and FEV1. Handgrip strength was not associated with BsmI genotype.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The main findings of this study were that the C allele of the FokI polymorphism of the VDR was associated with skeletal muscle strength in both patients and healthy control subjects, whereas the BsmI polymorphism was associated with strength only in patients. There was an interaction between the BsmI and the ACE(I/D) polymorphisms.

The finding that the C allele of the FokI polymorphism was associated with reduced quadriceps strength in both patients and control subjects is consistent with previous findings in healthy elderly men (18), although, in that study, the association with strength was not significant if adjustment was made for FFM. In contrast, our data show a stronger correlation if QMVC is corrected for FFM. The C allele has been associated with greater VDR activity, which, given the positive association of vitamin D stores and strength, is the opposite of what might be expected. It should be borne in mind, however, that this association may be influenced by other cotranscription factors, so that the effect of genotype-dependent differences may be cell-type-specific or organ-specific. The effect of this variant on strength did not differ between patients and control subjects.

Vitamin D deficiency is associated with weakness, which tends to be proximal (24), and several cross-sectional studies have shown an association between low vitamin D stores and skeletal muscle impairment (25-27). Biopsies in a handful of cases showed predominantly Type II fiber atrophy and fiber necrosis and fatty infiltration (28-30). Possible mechanisms are reduced calcium uptake by the sarcoplasmic reticulum and phosphate depletion that impairs glycolysis (31). Vitamin D has effects on muscle through genomic and nongenomic mechanisms. It binds to a nuclear receptor, and the ligand receptor complex causes mRNA transcription and protein synthesis, which in turn influence calcium uptake, phosphate transport, and phospholipid metabolism. Receptor binding also drives cell proliferation and differentiation into mature muscle fibers (32) through a mechanism involving the mitogen-activated protein kinase pathway (33, 34). Data from knockout mice suggest that the VDR plays a role in muscle differentiation (35). In addition, nongenomic signal transduction occurs more rapidly through binding to a membrane-bound VDR, which enhances calcium uptake (36, 37). VDR expression decreases with age (38), and that change may play an important role in the loss of strength that occurs with aging. Systemic inflammation is a feature of COPD, and vitamin D is involved in the immune response, inhibiting lymphocyte proliferation and the secretion of cytokines, including interleukin-2, interferon-{gamma}, and interleukin-12 (14).

Our data support a significant role for the BsmI variant in determining quadriceps strength in patients with COPD. The BsmI site is not itself thought to have a functional effect, and, thus, its effects on phenotype must be due to its being in linkage disequilibrium with another functional allele. Of note, several studies have failed to show the FokI polymorphism to be in linkage disequilibrium with any of the other known VDR polymorphisms, which agrees with the findings in the present study (14). The DNA change creating the BsmI is in strong linkage disequilibrium with the polyA variable number of tandem repeats (VNTR) in the 3' untranslated region (UTR) of the regulatory region of the VDR gene, so that the b allele is associated with a long polyA stretch and the B allele is associated with a short one (19, 39). The 3' UTR is known to play an important role in regulating gene expression—eg, polymorphisms in this area of the glucocorticoid receptor alpha have been shown to influence mRNA stability (40). There is some evidence that the long polyA stretch may be associated with higher VDR activity in combination with the C allele of FokI. This greater activity could result from increased translational activity, greater mRNA stability, or both (16). These mechanisms remain to be elucidated, however, and studies measuring a range of vitamin D–dependent outcomes have provided conflicting data, as reviewed by Uitterlinden et al (14).

The BsmI effect that we found in COPD patients is consistent with the finding in previous studies of greater quadriceps strength in nonobese elderly women with the b allele (20). It is interesting that the authors of that study found a nonsignificant trend in the opposite direction in obese [body mass index (in kg/m2) > 30] subjects. By contrast, in a study of younger women, the b allele was associated with lower weight and FFM and with lower hamstring strength, although there was no difference in quadriceps strength (19). Another study found lower quadriceps peak torque in young Chinese women with the bb genotype (41). This discrepancy suggests that the VDR polymorphism may exert different influences in different stages of life or, alternatively, that larger studies are required to resolve the issue.

We previously found an association between quadriceps strength and the I/D polymorphism of the ACE and the + 9/–9 polymorphism of BK2R in this group of patients (10, 11). In COPD, the D allele of the ACE gene (associated with greater tissue ACE) was associated with preserved quadriceps strength in a linear fashion across genotype, whereas patients homozygous for the +9 allele (associated with reduced expression of BK2R) had less FFM. Neither polymorphism influenced strength or FFM in the control group. In the present study, we found that the effect of BsmI genotype was lowest in patients who were homozygous for the I allele of the ACE gene. Both the ACE and BsmI polymorphisms affected strength in patients with COPD but not in control subjects. The ACE polymorphism has known effects on fiber type: the D allele favors Type II fast-twitch fibers and a strength phenotype, whereas the I allele is associated with a higher proportion of Type I slow-twitch, fatigue-resistant fibers (42) and a greater response to inflammation (43). This association may be relevant because it is implicated in the loss of skeletal muscle strength in COPD patients, and because vitamin D influences inflammatory responses (14). Thus, the variation in strength associated with the BsmI variant may be fiber type–specific, or it may be influenced by the presence of a greater systemic or local inflammatory response. A recent study showed a relation between ACE gene polymorphism and secondary hyperparathyroidism in patients on hemodialysis; higher parathyroid concentrations and greater cumulative vitamin D requirements were found in patients with the DD genotype than in those ≥1 T allele (44). The VDR may act by influencing the regulation of insulin-like growth factor (IGF-1)–binding protein (45), which is of interest because muscle-specific expression of IGF-1 has been shown to block angiotensin II–induced muscle wasting (46). Vitamin D itself acts as a potent suppressor of the renin-angiotensin system (47), which indicates that an effect of the VDR would be less pronounced when ACE concentrations are lower.

The VDR is widely distributed and has several different effects. An interesting observation is that the VDR is co-activated by peroxisome proliferator–activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), which is expressed in skeletal muscle and which promotes mitochondrial biogenesis (48). PGC-1{alpha} activates various transcription factors including PPAR{alpha}, PPAR{delta}, and PPAR{gamma}. The PPARs mediate lipid and carbohydrate metabolism in skeletal muscle and may determine fiber type (49, 50). PPAR{gamma} is the target of the glitazone drugs recently introduced to treat insulin resistance, and the b allele has been shown to be associated with lower fasting glucose concentrations in young men who did not take part in high levels of physical activity (51).

We acknowledge that data from the subjects in the present study were reported previously. Apart from the polymorphisms described here, no other genetic testing has been carried out, and the decision to investigate the VDR polymorphisms in an existing, well-phenotyped cohort was driven by published data and biological plausibility.

In conclusion, we have identified associations between VDR polymorphisms and strength in patients with COPD. This finding suggests that this receptor has a significant influence on one of the important complications of this disease and that it may be a useful future area for research into mechanisms of skeletal muscle impairment in COPD and other diseases.


    ACKNOWLEDGMENTS
 
The authors’ responsibilities were as follows—NSH, HM, MIP, and JM: study conception; NSH: patient studies and collection of specimens for analysis; KWL, AK, and SHE: genotyping of the samples; NSH, SHE, and MR: statistical analysis; NSH: writing of the first draft of the manuscript; and all authors: contributions to revision of the manuscript and approval of the final version. None of the authors had a personal or financial conflict of interest.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hamilton A, Killian K, Summers E, Jones N. Muscle strength, symptom intensity, and exercise capacity in patients with cardiorespiratory disorders. Am J Respir Crit Care Med 1995;152:2021–31.[Abstract]
  2. Bernard S, LeBlanc P, Whittom F, et al. Peripheral muscle weakness in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1998;158:629–34.[Abstract/Free Full Text]
  3. Gosselink R, Troosters T, Decramer M. Peripheral muscle weakness contributes to exercise limitation in COPD. Am J Respir Crit Care Med 1996;153:976–80.[Abstract]
  4. Steiner MC, Singh SJ, Morgan MD. The contribution of peripheral muscle function to shuttle walking performance in patients with chronic obstructive pulmonary disease. J Cardiopulm Rehabil 2005;25:43–9.[Medline]
  5. Marquis K, Debigare R, Lacasse Y, et al. Midthigh muscle cross-sectional area is a better predictor of mortality than body mass index in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2002;166:809–13.[Abstract/Free Full Text]
  6. Swallow EB, Reyes D, Hopkinson NS, et al. Quadriceps strength predicts mortality in patients with moderate to severe chronic obstructive pulmonary disease. Thorax 2007;62:115–20.[Abstract/Free Full Text]
  7. Skeletal muscle dysfunction in chronic obstructive pulmonary disease. A statement of the American Thoracic Society and European Respiratory Society. Am J Respir Crit Care Med 1999;159:2S–40.[Free Full Text]
  8. Arden NK, Spector TD. Genetic influences on muscle strength, lean body mass, and bone mineral density: a twin study. J Bone Miner Res 1997;12:2076–81.[Medline]
  9. Carmelli D, Kelly-Hayes M, Wolf PA, et al. The contribution of genetic influences to measures of lower-extremity function in older male twins. J Gerontol A Biol Sci Med Sci 2000;55:B49–53.[Abstract]
  10. Hopkinson NS, Eleftheriou KI, Payne J, et al. +9/+9 Homozygosity of the bradykinin receptor gene polymorphism is associated with reduced fat-free mass in chronic obstructive pulmonary disease. Am J Clin Nutr 2006;83:912–7.[Abstract/Free Full Text]
  11. Hopkinson NS, Nickol AH, Payne J, et al. Angiotensin converting enzyme genotype and strength in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2004;170:395–9.[Abstract/Free Full Text]
  12. Pfeifer M, Begerow B, Minne HW. Vitamin D and muscle function. Osteoporos Int 2002;13:187–94.[Medline]
  13. Costa EM, Blau HM, Feldman D. 1,25-Dihydroxyvitamin D3 receptors and hormonal responses in cloned human skeletal muscle cells. Endocrinology 1986;119:2214–20.[Abstract/Free Full Text]
  14. Uitterlinden AG, Fang Y, van Meurs JBJ, Pols HAP, van Leeuwen JPTM. Genetics and biology of vitamin D receptor polymorphisms. Gene 2004;338:143–56.[Medline]
  15. Arai H, Miyamoto K-I, Taketani Y, et al. A vitamin D receptor gene polymorphism in the translation initiation codon: effect on protein activity and relation to bone mineral density in Japanese women. J Bone Miner Res 1997;12:915–21.[Medline]
  16. Whitfield GK, Remus LS, Jurutka PW, et al. Functionally relevant polymorphisms in the human nuclear vitamin D receptor gene. Mol Cell Endocrinol 2001;177:145–59.[Medline]
  17. Colin EM, Weel AE, Uitterlinden AG, et al. Consequences of vitamin D receptor gene polymorphisms for growth inhibition of cultured human peripheral blood mononuclear cells by 1, 25-dihydroxyvitamin D3. Clin Endocrinol (Oxf) 2000;52:211–6.[Medline]
  18. Roth SM, Zmuda JM, Cauley JA, Shea PR, Ferrell RE. Vitamin D receptor genotype is associated with fat-free mass and sarcopenia in elderly men. J Gerontol A Biol Sci Med Sci 2004;59:10–5.[Medline]
  19. Grundberg E, Brandstrom H, Ribom EL, Ljunggren O, Mallmin H, Kindmark A. Genetic variation in the human vitamin D receptor is associated with muscle strength, fat mass and body weight in Swedish women. Eur J Endocrinol 2004;150:323–8.[Abstract]
  20. Geusens P, Vandevyver C, Vanhoof J, Cassiman JJ, Boonen S, Raus J. Quadriceps and grip strength are related to vitamin D receptor genotype in elderly nonobese women. J Bone Miner Res 1997;12:2082–8.[Medline]
  21. Steiner MC, Barton RL, Singh SJ, Morgan MD. Bedside methods versus dual energy X-ray absorptiometry for body composition measurement in COPD. Eur Respir J 2002;19:626–31.[Abstract/Free Full Text]
  22. Engelen MP, Schols AM, Baken WC, Wesseling GJ, Wouters EF. Nutritional depletion in relation to respiratory and peripheral skeletal muscle function in out-patients with COPD. Eur Respir J 1994;7:1793–7.[Abstract]
  23. Engelen MP, Schols AM, Lamers RJ, Wouters EF. Different patterns of chronic tissue wasting among patients with chronic obstructive pulmonary disease. Clin Nutr 1999;18:275–80.[Medline]
  24. Schott GD, Wills MR. Muscle weakness in osteomalacia. Lancet 1976;1:626–9.[Medline]
  25. Bischoff HA, Stahelin HB, Urscheler N, et al. Muscle strength in the elderly: its relation to vitamin D metabolites. Arch Phys Med Rehabil 1999;80:54–8.[Medline]
  26. Mowe M, Haug E, Bohmer T. Low serum calcidiol concentration in older adults with reduced muscular function. J Am Geriatr Soc 1999;47:220–6.[Medline]
  27. Glerup H, Mikkelsen K, Poulsen L, et al. Hypovitaminosis D myopathy without biochemical signs of osteomalacic bone involvement. Calcif Tissue Int 2000;66:419–24.[Medline]
  28. Ziambaras K, Dagogo-Jack S. Reversible muscle weakness in patients with vitamin D deficiency. West J Med 1997;167:435–9.[Medline]
  29. Russell JA. Osteomalacic myopathy. Muscle Nerve 1994;17:578–80.[Medline]
  30. Yoshikawa S, Nakamura T, Tanabe H, Imamura T. Osteomalacic myopathy. Endocrinol Jpn 1979;26:65–72.[Medline]
  31. Birge SJ, Haddad JG. 25-Hydroxycholecalciferol stimulation of muscle metabolism. J Clin Invest 1975;56:1100–7.[Medline]
  32. Holick MF. Noncalcemic actions of 1,25-dihydroxyvitamin D3 and clinical applications. Bone 1995;17:107S–11S.[Medline]
  33. Buitrago CG, Pardo VG, de Boland AR, Boland R. Activation of RAF-1 through Ras and protein kinase Calpha mediates 1alpha,25(OH)2-vitamin D3 regulation of the mitogen-activated protein kinase pathway in muscle cells. J Biol Chem 2003;278:2199–205.[Abstract/Free Full Text]
  34. Morelli S, Buitrago C, Vazquez G, De Boland AR, Boland R. Involvement of tyrosine kinase activity in 1alpha,25(OH)2-vitamin D3 signal transduction in skeletal muscle cells. J Biol Chem 2000;275:36021–8.[Abstract/Free Full Text]
  35. Endo I, Inoue D, Mitsui T, et al. Deletion of vitamin D receptor gene in mice results in abnormal skeletal muscle development with deregulated expression of myoregulatory transcription factors. Endocrinology 2003;144:5138–44.[Abstract/Free Full Text]
  36. de Boland AR, Morelli S, Boland R. 1,25(OH)2-vitamin D3 signal transduction in chick myoblasts involves phosphatidylcholine hydrolysis. J Biol Chem 1994;269:8675–9.[Abstract/Free Full Text]
  37. Norman AW, Nemere I, Zhou LX, et al. 1,25(OH)2-vitamin D3, a steroid hormone that produces biologic effects via both genomic and nongenomic pathways. J Steroid Biochem Mol Biol 1992;41:231–40.[Medline]
  38. Bischoff-Ferrari HA, Borchers M, Gudat F, Durmuller U, Stahelin HB, Dick W. Vitamin D receptor expression in human muscle tissue decreases with age. J Bone Miner Res 2004;19:265–9.[Medline]
  39. Ingles SA, Haile RW, Henderson BE, et al. Strength of linkage disequilibrium between two vitamin D receptor markers in five ethnic groups: implications for association studies. Cancer Epidemiol Biomarkers Prev 1997;6:93–8.[Abstract]
  40. Schaaf MJ, Cidlowski JA. AUUUA motifs in the 3'UTR of human glucocorticoid receptor alpha and beta mRNA destabilize mRNA and decrease receptor protein expression. Steroids 2002;67:627–36.[Medline]
  41. Wang P, Ma LH, Wang HY, et al. Association between polymorphisms of vitamin D receptor gene ApaI, BsmI and TaqI and muscular strength in young Chinese women. Int J Sports Med 2006;27:182–6.[Medline]
  42. Zhang B, Tanaka H, Shono N, et al. The I allele of the angiotensin-converting enzyme gene is associated with an increased percentage of slow-twitch type I fibers in human skeletal muscle. Clin Genet 2003;63:139–44.[Medline]
  43. Carter CS, Onder G, Kritchevsky SB, Pahor M. Angiotensin-converting enzyme inhibition intervention in elderly persons: effects on body composition and physical performance. J Gerontol A Biol Sci Med Sci 2005;60:1437–46.[Abstract/Free Full Text]
  44. Kulah E, Sezer S, Uyar M, Arat Z, Ozdemir FN. Effects of ACE gene polymorphism on vitamin D therapy according to parathyroid hormone level in patients on hemodialysis. Adv Ther 2006;23:778–86.[Medline]
  45. Sweeney C, Murtaugh MA, Baumgartner KB, et al. Insulin-like growth factor pathway polymorphisms associated with body size in Hispanic and non-Hispanic white women. Cancer Epidemiol Biomarkers Prev 2005;14:1802–9.[Abstract/Free Full Text]
  46. Song YH, Li Y, Du J, Mitch WE, Rosenthal N, Delafontaine P. Muscle-specific expression of IGF-1 blocks angiotensin II-induced skeletal muscle wasting. J Clin Invest 2005;115:451–8.[Medline]
  47. Li YC, Kong J, Wei M, Chen Z-F, Liu SQ, Cao L-P. 1,25-Dihydroxyvitamin D3 is a negative endocrine regulator of the renin-angiotensin system. J Clin Invest 2002;110:229–38.[Medline]
  48. Savkur RS, Bramlett KS, Stayrook KR, Nagpal S, Burris TP. Coactivation of the human vitamin D receptor by the peroxisome proliferator-activated receptor gamma coactivator-1 alpha. Mol Pharmacol 2005;68:511–7.[Abstract/Free Full Text]
  49. Luquet S, Lopez-Soriano J, Holst D, et al. Peroxisome proliferator-activated receptor delta controls muscle development and oxidative capability. FASEB J 2003;17:2299–301.[Abstract/Free Full Text]
  50. Wang YX, Zhang CL, Yu RT, et al. Regulation of muscle fiber type and running endurance by PPARdelta. PLoS Biol 2004;2:e294.[Medline]
  51. Ortlepp JR, Metrikat J, Albrecht M, von Korff A, Hanrath P, Hoffmann R. The vitamin D receptor gene variant and physical activity predicts fasting glucose levels in healthy young men. Diabet Med 2003;20:451–4.[Medline]
Received for publication August 29, 2007. Accepted for publication September 19, 2007.




This article has been cited by other articles:


Home page
Am. J. Respir. Crit. Care Med.Home page
W. Janssens, A. Lehouck, C. Carremans, R. Bouillon, C. Mathieu, and M. Decramer
Vitamin D Beyond Bones in Chronic Obstructive Pulmonary Disease: Time to Act
Am. J. Respir. Crit. Care Med., April 15, 2009; 179(8): 630 - 636.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hopkinson, N. S
Right arrow Articles by Polkey, M. I
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hopkinson, N. S
Right arrow Articles by Polkey, M. I
Agricola
Right arrow Articles by Hopkinson, N. S
Right arrow Articles by Polkey, M. I


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS