HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) An erratum has been published Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lee, S.-A. Articles by Zheng, W. Search for Related Content PubMed PubMed Citation Articles by Lee, S.-A. Articles by Zheng, W. Agricola Articles by Lee, S.-A. Articles by Zheng, W.

Cruciferous vegetables, the GSTP1 Ile¹⁰⁵Val genetic polymorphism, and breast cancer risk^1,2,3

¹ From the Vanderbilt Epidemiology Center, Vanderbilt University Medical Center, Nashville, TN (S-AL, JHF, CY, QC, XS, and WZ); the Shanghai Center for Disease Control and Prevention, Shanghai, China (WL, YZ, and KG); and the Department of Epidemiology, Shanghai Cancer Institute, Shanghai, China (Y-TG)

² Supported by RO1 CA 64277 and RO1 CA 90899 from the National Cancer Institute.

³ Reprints not available. Address correspondence to JH Fowke, Institute for Medicine & Public Health, Vanderbilt University Medical Center, 6th floor, Suite 600, 2525 West End Avenue, Nashville, TN 37203-1738. E-mail: jay.fowke{at}vanderbilt.edu.

	ABSTRACT

TOP ABSTRACT INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION REFERENCES

 
Background: Cruciferous vegetables are the primary source of isothiocyanates and other glucosinolate derivatives that are known to induce phase II detoxifying enzymes, including glutathione S-transferases (GSTs).

Objective: We investigated the independent and combined effects of cruciferous vegetable intake and the GSTP1 Ile¹⁰⁵Val genetic polymorphism on breast cancer risk.

Design: Analyses included 3035 cases and 3037 population controls who were participating in the Shanghai Breast Cancer Study and for whom diet and genetic data were complete (87% of cases and 85% of controls).

Results: With the use of multivariate logistic regression, the GSTP1 Val/Val genotype was significantly associated with greater breast cancer risk (OR = 1.50; 95% CI: 1.12, 1.99). The association was significantly greater in premenopausal women (OR = 1.69; 95% CI: 1.17, 2.43) than in postmenopausal women (OR = 1.20; 95% CI: 0.74, 1.92). Total cruciferous vegetable intake was not significantly associated with breast cancer risk, although subjects reporting greater turnip (P for trend < 0.001) and Chinese cabbage (P for trend = 0.049) intakes had a significantly lower postmenopausal breast cancer risk. Women with the GSTP1 Val/Val genotype and low cruciferous vegetable intake had a breast cancer risk 1.74-fold (95% CI: 1.13, 2.67) that of women with the Ile/Ile or Ile/Val genotype. This effect of low cruciferous vegetable intake and the Val/Val genotype was seen predominantly among premenopausal women (OR = 2.08; 95% CI = 1.20, 3.59).

Conclusions: Cruciferous vegetable intake consistent with high isothiocyanate exposure may reduce breast cancer risk. Cruciferous vegetable intake also may ameliorate the effects of the GSTP1 genotype.

Key Words: Cruciferous vegetables • GSTP1 genetic polymorphism • breast cancer risk • gene-diet combined effect

	INTRODUCTION

TOP ABSTRACT INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cruciferous vegetable are an especially rich source of glucosinolates, which may be converted by plant myrosinase and the gastrointestinal microflora to isothiocyanates, indole-3-carbinol, and other compounds believed to have anticancer properties. These agents may affect carcinogenesis through several mechanisms, including the induction of apoptosis and a shift in estrogen metabolism to favor metabolites with lower estrogenic activity (1, 2). In addition, isothiocyanates induce multiple phase II conjugating enzyme systems (3, 4), including glutathione S-transferases (GSTs), through nuclear transcription factor–E2–related factor 2–enhanced transcription (5, 6). The overall effects of cruciferous vegetable intake appear to be a reduction in systemic oxidative stress (7) and a suppression of mutagenic and carcinogenic activity (8). Indeed, cruciferous vegetable intake has been inversely associated with the risk of lung, stomach, colorectal, bladder, and other cancers (9, 10). However, despite strong biologic plausibility, the relation between cruciferous vegetable intake and breast cancer risk is unclear. Several studies found no association between total or cruciferous vegetable intake and breast cancer risk (10–13). In contrast, case-control studies from Sweden (14), the United States (in premenopausal women) (15), and Shanghai (16) reported a reduction in breast cancer risk associated with cruciferous vegetable intake.

The capacity of cruciferous vegetable intake to affect breast cancer risk may depend on the inherent metabolic activity. GSTs target a broad range of electrophilic compounds for conjugation with glutathione, which leads to a reduction in organic hydroepoxide concentrations (17). The role of GSTP1 in breast carcinogenesis remains unclear (18). A transition from an A to a G nucleotide position 313 leads to an Ile¹⁰⁵Val amino acid change and, perhaps, also to greater thermal stability. Substrate specificity also may differ by GSTP1 genotype: the GSTP1 Val allele is reported to have greater in vitro activity toward 1-chloro-2,4-dinitrobenzene (19). This may suggest an effect of the hydrophobic substrate–binding site. Several studies have reported an association of the GSTP1 Val/Val genotype with greater breast cancer risk (20–22), although subsequent studies reported mixed or conflicting results for the GSTP1 Val/Val polymorphism with respect to breast cancer (23–28). These inconsistencies in the relations between GSTP1 genetic polymorphism and breast cancer suggest that the effects of the GSTP1 genotype may depend on environmental factors such as cruciferous vegetable intake.

GSTs catalyze the conjugation of glutathione with isothiocyanates (electrophilic compounds) to facilitate membrane transport and excretion of isothiocyanates (29), thus, perhaps, first increasing the availability of isothiocyanates but ultimately reducing their systemic concentrations. A previous study by our group (30) found that urinary isothiocyanate concentrations are higher in Shanghai women with the GSTP1 Val/Val genotype than in those with other genotypes, which suggests that GSTP1 genotypes may affect the persistence of isothiocyanates in the body. Three earlier studies reported a combined effect of the genetic polymorphisms of GSTM1/T1/A1 and cruciferous vegetable intake on breast cancer (15, 16, 31). However, the combined effect of the GSTP1 Ile¹⁰⁵Val polymorphism and cruciferous vegetable intake on breast cancer risk has not been investigated. Thus, the goal of the present study was to investigate the relation among cruciferous vegetable intake, the GSTP1 genotype, and breast cancer risk.

	SUBJECTS AND METHODS

TOP ABSTRACT INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION REFERENCES

 
Subjects
The Shanghai Breast Cancer Study (SBCS) is a population-based case-control study conducted in Shanghai, China. Detailed study methods were reported elsewhere (32). Cancer cases between 25 and 64 y of age were identified through a rapid case-ascertainment system, supplemented by the population-based Shanghai Cancer Registry, which provided a virtually complete ascertainment of incident breast cancer cases diagnosed by pathologists among urban Shanghai residents. From 1996 through 1998 (SBCS I), a total of 1598 eligible breast cancer cases were identified, of which 1455 (91%) completed in-person interviews. Characterization of tumors as estrogen receptor (ER)–or progesterone receptor (PR)–positive or –negative in SBCS I found that 52.8%, 10.8%, 10.5%, and 25.9% were defined as ER+/PR+, ER+/PR–, ER–/PR+, and ER–/PR–, respectively. Most cases (82.2%) were diagnosed with stage I or II cancer; 10.8% had stage III/IV cancer, and 7.0% had cancer of unknown stage (33). Controls were randomly selected from the general population of Shanghai by using the Shanghai Resident Registry, a population registry containing demographic information on all adult residents of urban Shanghai. The inclusion criteria for controls were identical to those for cases save for the cancer diagnosis. Of the 1724 eligible women, 1556 (90%) completed in-person interviews. To enhance the statistical power of the study, we recruited a second set of cases and controls between April 2002 and February 2005 (SBCS II) by using a protocol similar to that described above, although the age range of SBCS II was expanded to ages 20–70 y. A total of 1997 (84%) cases and 1918 (70%) controls were recruited to SBCS II, and information on ER/PR status will be reported in the future. Participants in SBCS II tended to be somewhat older, more educated, and more likely to be postmenopausal than were participants in SBCS I, perhaps because of the greater age range, but, overall, the participant characteristics in SBCS I and SBCS II were highly comparable (Table 1).

Genotyping
Genomic DNA was extracted from buffy coat fractions or buccal cells by using the Puregene DNA Isolation Kit (Gentra Systems, Minneapolis, MN) or the QIAmp DNA Mini-kit (Qiagen, Valencia, CA) according to each manufacturer's protocol. DNA concentration were measured by using the PicoGreen dsDNA Quantitation Kit (Molecular Probes, Eugene, OR). Five to 10 ng of genomic DNA was used for each polymerase chain reaction (PCR). Quality-control (QC) samples (ie, water, CEPH 1347–02 DNA, and blinded and nonblinded DNA samples) were included in the genotyping assay.

For the SBCS I samples, the GSTP1 Ile¹⁰⁵Val polymorphism (A313G, rs1695) was determined by the PCR-restriction fragment length polymorphism method reported previously (21). The PCR products were digested by using BsmAI restriction endonuclease. The PCR product with the G allele was digested to 2 fragments (148 and 41 bp), whereas the PCR product with the A allele remained undigested (189 bp). Genotyping was successfully completed for 1129 (95%) cases and 1236 (94%) controls in SBCS I.

For the 1897 (98%) cases and 1801 (97%) controls in SBCS II, the GSTP1 Ile¹⁰⁵Val polymorphism (rs1695) was assessed with the use of the ABI PRISM 7900 Sequence Detection System [Applied Biosystems (ABI), Foster City, CA] in the TaqMan genotyping assay with primers and probes obtained from ABI. The primers were 5'- CCTGGTGGACATGGTGAATGAC-3' and 5'- TGGTGCAGATGCTCACATAGTTG –3'. The probes were VIC-CTGCAAATACATCTCC and FAM-CTGCAAATACGTCTCC. The TaqMan assay method was described previously (34). Briefly, the final volume for each reaction was 5 µL; it consisted of 2.5 µL TaqMan Universal PCR Master Mix, 0.6 µL of each primer, 0.2 µL of each TaqMan probe, and 5 ng genomic DNA. The PCR profile consisted of an initial denaturation step at 95 °C for 10 min and 40 cycles of 92 °C for 15 s and 60 °C for 1 min. The fluorescence level was measured with the ABI PRISM 7900HT sequence detector (Applied Biosystems). Allele frequencies were determined by using ABI SDS software (version 2.2; Applied Biosystems).

Genotyping was successfully completed for 1846 (95%) cases and 1727 (93%) controls in SBCS II. The laboratory staff was blind to the identity of the subjects. QC samples were included in the genotyping assays. Each 384-well plate contained 4 water, 8 CEPH 1347–02 DNA, and 8 blinded QC DNA samples. We genotyped the GSTP1 Ile¹⁰⁵Val polymorphism in 45 DNA samples of the Chinese participants used in the International HapMap Project and 24 DNA samples used in Perlegen Sciences human genomic datasets as an additional QC step. The genotypes of the samples generated from the present study were compared with data downloaded from the International HapMap Project (Internet: http://www.hapmap.org) and Perlegen Sciences (Internet: http://genome.perlegen.com). The concordance rates for the QC samples were 98.3% and 100% for SBCS I and II, respectively. The rate of concordance between the data generated in our laboratory and the data from the above databases was 100%. GSTP1 genotypes did not significantly differ from Hardy-Weinberg equilibrium.

Dietary assessment
Habitual intakes of cruciferous vegetables were measured by using a validated food-frequency questionnaire (35). During the in-person interview, each participant was first asked how often each food item or food group was consumed and then asked how many liangs (1 liang = 50 g) of each food were eaten per unit of time (ie, d, wk, mo, or y) during the past 5 y. Five cruciferous vegetables common in Shanghai were listed as separate items on the food-frequency questionnaire, including Chinese greens (bok choy), green cabbage, Chinese cabbage (nappa), cauliflower, and white turnip. From this information, we calculated the average intake (in g/d) of each cruciferous vegetable. Furthermore, we estimated dietary isothiocyanate exposure by using previously published isothiocyanate concentrations for cruciferous vegetables grown in Singapore and cooked in boiling water (36). The report showed considerable variation in potential isothiocyanate contribution across the cruciferous vegetables analyzed, ranging from 4.9 µmol/100 g wet weight in bok choy (Braccica chinensis) to 81.3 µmol/100 g wet weight in watercress.

Statistical analysis
Separate analyses in SBCS I and II were comparable, and thus we pooled the SBCS I and II data for these analyses. Study participants were classified into 5 categories by quintile of the intake of each cruciferous vegetable. The lowest quintile served as the reference group in the analyses. Odds ratios (ORs) and 95% CIs summarizing the association between breast cancer risk and cruciferous vegetable intake or GSTP1 genotype were calculated by using unconditional logistic regression after adjustment for age, education, family history of breast cancer, age at menarche, body mass index (BMI; in kg/m²), age at first live birth, regular exercise, total energy intake, and study stage (SBCS I or II). Stratified analyses were performed to investigate any interaction or combined effect between the GSTP1 genotypes and cruciferous vegetable intake. We also repeated analyses after excluding the contribution of bok choy intake, because bok choy was frequently consumed in this study population but may have a lower isothiocyanate content than other cruciferous vegetables. Tests for interaction were performed by comparing the model with and without interaction terms by using a likelihood ratio test. All statistical tests were based on 2-sided probability. Statistical analyses were carried out with SAS software (version 9.1; SAS Institute, Cary, NC).

	RESULTS

TOP ABSTRACT INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION REFERENCES

 
Breast cancer cases and controls were of a similar age and did not significantly differ in reported intakes of energy, total vegetables, fruit, or cruciferous vegetables. Significant case-control differences were observed with regard to education, family history of breast cancer, age at menarche, menopause status, age at menopause, age at first live birth, BMI, waist-to-hip ratio, regular exercise, and intakes of red meat, poultry, and fish (SBCS I and II combined; see Table 1).

The association between cruciferous vegetable intake and breast cancer is shown in Table 2. Total cruciferous vegetable intake was not significantly associated with premenopausal (P for trend = 0.859) or postmenopausal (P for trend = 0.142) breast cancer risk. On the other hand, estimated isothiocyanate exposure was significantly associated with lower breast cancer risk among women in quintile 5 (OR = 0.82; 95% CI: 0.70, 0.96; P for trend = 0.007), particularly the postmenopausal women (OR = 0.68; 95% CI: 0.53, 0.87; P for trend < 0.001). Turnip consumption was significantly associated with lower breast cancer risk among quintile 5 premenopausal (OR = 0.81; 95% CI: 0.67, 0.97; P for trend = 0.065) and postmenopausal (OR = 0.65; 95% CI: 0.52, 0.83; P for trend < 0.001) women, whereas Chinese cabbage was significantly associated with lower breast cancer risk among quintile 5 postmenopausal women (OR = 0.76; 95% CI: 0.60, 0.96; P for trend = 0.049). We removed bok choy from our total cruciferous vegetable intake score and found that intakes of the remaining cruciferous vegetables were significantly associated with lower postmenopausal breast cancer risk [from quintile 1 to quintile 5: OR = 1.00 (ref), 0.98, 0.77, 0.77, 0.83, and 0.76, respectively (95% CI: 0.58, 0.97); P for trend = 0.014]. We also found no association between total cruciferous vegetable intake minus bok choy and premenopausal breast cancer (data not shown).

Table 3

Table 4

	DISCUSSION

TOP ABSTRACT INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION REFERENCES

Reports from Sweden and the United States (in premenopausal women) suggested a lower effect of high cruciferous vegetable intake on breast cancer risk (14, 15). Smith-Warner et al (11) found that broccoli and Brussels sprout consumption was associated with a 14% reduction in the risk in postmenopausal women. The associations between overall cruciferous vegetable intake and breast cancer risk seen in the present study were more consistent with the modest and nonsignificant associations observed in prior European Prospective Investigation into Cancer and Nutrition analyses (12). Nonetheless, we found white turnip and Chinese cabbage intakes to be inversely associated with breast cancer risk, predominantly among postmenopausal women. Turnip is consumed more regularly in Shanghai than in the West (36), and 66.3% of participants in this study reported consuming some amount of turnip. Wang et al (37) suggested that different cruciferous vegetables may not represent unique exposures because the glucosinolate profile varies across species. Similarly, Jiao et al (36) estimated turnip isothiocyanate concentrations to be 17-fold those of bok choy, which is a more widely consumed cruciferous vegetable in the Chinese population. Accordingly, associations between estimated isothiocyanate intake and breast cancer risk tracked well with associations between turnip intake and breast cancer risk, and total cruciferous vegetable intake was also associated with postmenopausal breast cancer when the intake of bok choy was excluded from the total cruciferous vegetable intake. Thus, our results suggest that turnip or other cruciferous vegetables with a high isothiocyanate content may reduce postmenopausal breast cancer risk. We cannot address the potential for systematic errors associated with applying isothiocyanate concentrations derived from cruciferous vegetables in Singapore (36) to our study population in Shanghai.

The GSTP1Val allele frequency of 18.4% in controls is more prevalent than that typically observed in white populations, which is usually 5–10% (20, 24, 38, 39). Zimniak et al (19) reported that the GSTP1 Val104 isoform differs in affinity for electrophilic substrates. Several earlier studies found no significant overall association between the GSTP1 Ile¹⁰⁵Val polymorphism and breast cancer risk (23–26), and the GSTP1 Val allele has been associated with a lower risk in Finnish women, both premenopausal and postmenopausal (27), and in postmenopausal Korean women (28). However, we found the GSTP1 Val/Val genotype to be significantly associated with greater breast cancer risk, a finding that is consistent with the findings of other studies (20, 22) and previous analyses by our group (16, 21). The risk association with this polymorphism was more pronounced among premenopausal women, which is consistent with the common belief that genetic factors play a more important role in breast cancer diagnosed in young women than in that diagnosed in older women. Discrepancies between the results of the present study and those of earlier studies cannot be easily explained by the genetic variability associated with ethnicity or race alone, and they suggest that environmental factors such as cruciferous vegetable intake may affect the genetic predisposition to breast cancer associated with GSTP1 genotype.

Dietary isothiocyanates induce GST enzyme activity (17, 40) and are associated with a reduction in indexes of systemic oxidative stress (7, 8). However, GSTs also conjugate isothiocyanates, and low GST activity could allow the protective effects of isothiocyanates to be exerted to a greater extent at the target tissue level. Overall, the results of epidemiologic studies to date most clearly support a combined GSTM1/T1-isothiocyanate effect on lung cancer risk, with more limited evidence for an effect on colon cancer risk (41). Limited data also suggest a GST-isothiocyanate effect on breast cancer risk (15, 16, 30). In the present study, high cruciferous vegetable intake reduced the strength of the association between the GSTP1 genetic polymorphisms and premenopausal breast cancer risk. We previously showed that urinary isothiocyanate concentrations are higher among Shanghai women with the GSTP1 Val/Val genotype than among those with other genotypes (30). Persons with the GSTP1 Val/Val genotype may excrete isothiocyanates more readily than those with another GSTP1 genotype, which may reduce the availability of isothiocyanates in the body and contribute to breast cancer risk. In such a situation, a low cruciferous vegetable intake would have the greatest effect among women with the GSTP1 Val/Val genotype. In contrast, higher cruciferous vegetable intake and isothiocyanate exposure may compensate to a degree for the greater isothiocyanate excretion observed with the GSTP1 Val/Val genotype.

These results could be affected by sources of bias that are common to case-control studies (eg, recall bias), although our rapid recruitment protocol was designed to minimize such sources of bias. Moreover, selection bias associated with diet or genotype is less likely, because of the high participation rates and population-based study design. Myrosinase activity and isothiocyanate availability may be affected by the method of food preparation (42, 43). Turnips are often consumed in an uncooked state in Shanghai, whereas most cruciferous vegetables are consumed after light cooking or stir-frying or in soups. It is unlikely that cooking methods vary substantially between cases and controls. Despite the pooling of data from 2 large studies, data within specific strata for analyses investigating the effects of cruciferous intake by genotype were sparse, and the observed patterns should be confirmed in other studies. Urinary isothiocyanate concentrations as a biomarker of cruciferous vegetable intake and internalized isothiocyanate exposure were not available for this analysis, but they will be investigated in the future. Nonetheless, this population-based study includes a sample size large enough to allow detection of relatively small associations and to explore combined gene-diet effects after adjustment for potentially confounding factors. Furthermore, total cruciferous vegetable intake was considered in a large number of subjects with high cruciferous vegetable intakes, and the evaluation included various cruciferous vegetables not as commonly consumed in other populations.

In summary, the cancer-preventive potential of cruciferous vegetable is believed to derive, in part, from the effects of isothiocyanates and other glucosinolate derivatives on phase II enzyme activity (2, 36). Greater intake of cruciferous vegetables with a higher isothiocyanate content was associated with lower postmenopausal breast cancer risk. In addition, we found that the GSTP1 Val/Val genotype was associated with a greater breast cancer risk, and premenopausal breast cancer risk was attenuated among women with a high cruciferous vegetable intake. This may suggest that a genetic predisposition to breast cancer related to GSTP1 genotype could be modified by cruciferous vegetable intake.

	ACKNOWLEDGMENTS

 
The authors' responsibilities were as follows—S-AL and JHF: contributed to hypothesis generation, result interpretation, and manuscript drafting and revision; S-AL conducted data analysis; WL, YZ, KG, Y-TG, XS, and WZ (principal investigator): designed the parent study, implemented and oversaw data collection, assisted in result interpretation, and participated in manuscript revisions; and QC: genotyping assay and interpretation of results. None of the authors had a personal or financial conflict of interest.

	REFERENCES

TOP ABSTRACT INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Yu R, Mandlekar S, Harvey KJ, Ucker DS, Kong ANT. Chemopreventive isothiocyanates induce apoptosis and caspase-3-like protease activity. Cancer Res 1998;58;402–8.[Abstract/Free Full Text]
2. Meng Q, Yuan F, Goldberg ID, Rosen EM, Auborn K, Fan S. Indole-3-carbinol is a negative regulator of estrogen receptor-alpha signaling in human tumor cells. J Nutr 2000;130:2927–31.[Abstract/Free Full Text]
3. Yang CS, Smith TJ, Hong JY. Cytochrom P450 enzymes as targets for chemoprevention against chemical carcinogenesis and toxicity: opportunities and limitations. Cancer Res 1994;54(suppl):1982s–6s.[Free Full Text]
4. Zhang Y, Talalay P. Anticarcinogenic activities of organic isothiocyanates: chemistry and mechanisms. Cancer Res 1994;54(suppl):1976s–81s.[Abstract/Free Full Text]
5. Lampe JW, Chen C, Li S, Prunty J, et al. Modulation of human glutathione S-transferases by botanically defined vegetable diets. Cancer Epidemiol Biomark Prev 2000;9:787–93.[Abstract/Free Full Text]
6. Lampe JW, Peterson S. Brassica, biotranformation and cancer risk: genetic polymorphisms alter the preventive effects of cruciferous vegetables. J Nutr 2002;132:2991–4.[Abstract/Free Full Text]
7. Fowke JH, Morrow JD, Motley S, Bostick RM, Ness RM. Brassica vegetable consumption reduces urinary F2-isoprostane levels independent of micronutrient intake. Carcinogenesis 2006;27:2096–102.[Abstract/Free Full Text]
8. Verhagen H, Poulsen HE, Loft S, van Poppel G, Willems MI, van Bladeren J. Reduction of oxidative DNA damage in humans by Brussels sprouts. Carcinogenesis 1995;16:969–70.[Abstract/Free Full Text]
9. Michaud DS, Spiegelaman D, Clinton SK, Rimm EB, Willett WC, Giovannucci EL. Fruit and vegetable intake and incidence of bladder cancer is a male prospective cohort. J Natl Cancer Inst 1999;91(7):605–13.[Abstract/Free Full Text]
10. Verhoeven DTH, Goldbohm RA, van Poppel G, Verhagen H, ven den Brandt PA. Epidemiological studies on brassica vegetables and cancer risk. Cancer Epidemiol Biomark Prev 1996;5:733–48.[Abstract/Free Full Text]
11. Smith-Warner SA, Spiegelman D, Yaun SS, et al. Intake of fruits and vegetables and risk of breast cancer: a pooled analysis of cohort studies. JAMA 2001;285:769–76.[Abstract/Free Full Text]
12. van Gils CH, Peeters PH, Bas Bueno-de-Mesquita H, et al. Consumption of vegetables and fruits and risk of breast cancer. JAMA 2005;293:183–93.[Abstract/Free Full Text]
13. Gandini S, Merzenich H, Robertson C, Boyle P. Meta-analysis of studies on breast cancer risk and diet: the role of fruit and vegetable consumption and the intake of associated micronutrients. Eur J Cancer 2000;36:636–46.[Medline]
14. Terry P, Wolk A, Persson I, Magnusson C. Brassica vegetables and breast cancer risk. JAMA 2001;285:2975–7.[Free Full Text]
15. Ambrosone CB, McCann S, Freudenheim JL, Marshall JR, Zhang Y, Shields PG. Breast cancer risk in premenopausal women is inversely associated with consumption of broccoli, a source of isothiocyanates, but is not modified by GST genotype. J Nutr 2004;134:1134–8.[Abstract/Free Full Text]
16. Fowke JH, Chung FL, Jin F, et al. Urinary isothiocyanate levels, brassica and human breast cancer. Cancer Res 2003;63:3980–6.[Abstract/Free Full Text]
17. Hayes JD, Pulford DJ. The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit Rev Biochem Mol Biol 1995;30:445–600.[Medline]
18. Salinas AE, Wong MG. Gluthatione S transferases: a review. Curr Med Chem 1999;6:279–309.[Medline]
19. Zimniak P, Nanduri B, Pikula S, et al. Naturally occurring human glutathione S-transferase GSTP-1 isoforms with isoleucine and valine in position 104 differ in enzymic properties. Eur J Biochem 1994;224(3):893–9.[Medline]
20. Helzlsouer KJ, Selmin O, Huang HY, et al. Association between glutathione S-transferase M1, P1, and T1 genetic polymorphisms and development of breast cancer. J Natl Cancer Inst 1998;90:512–8.[Abstract/Free Full Text]
21. Egan KM, Cai Q, Shu XO, et al. Genetic polymorphisms in GSTM1, GSTP1, and GSTT1 and the risk for breast cancer: results from the Shanghai Breast Cancer Study and meta-analysis. Cancer Epidemiol Biomark Prev 2004;13:197–204.[Abstract/Free Full Text]
22. Gudmundsdottir K, Tryggvadottir L, Eyfjord JE. GSTM1, GSTT1, and GSTP1 genotypes in relation to breast cancer risk and frequency of mutations in the p53 gene. Cancer Epidemiol Biomark Prev 2001;10:1169–73.[Abstract/Free Full Text]
23. Vogl FD, Taioli E, Maugard C, et al. Glutathione S-transferase M1, T1, and P1 and breast cancer: a pooled analysis. Cancer Epidemiol Biomark Prev 2004;13:1473–9.[Abstract/Free Full Text]
24. Millikan R, Pittman G, Tse CK, et al. Glutathione S-transferases M1, T1, and P1 and breast cancer. Cancer Epidemiol Biomark Prev 2000;9:567–73.[Abstract/Free Full Text]
25. Curran JE, Weinstein SR, Griffiths LR. Polymorphisms of glutathione S-transferase genes (GSTM1, GSTP1 and GSTT1) and breast cancer susceptibility. Cancer Lett 2000;153:113–20.[Medline]
26. Zhao M, Lewis R, Gustafson DR, Wen WQ, Cerhan JR, Zheng W. No apparent association of GSTP1 A313G polymorphism with breast cancer risk among postmenopausal Iowa Women. Cancer Epidemiol Biomark Prev 2001;10:1301–2.[Free Full Text]
27. Mitrunen K, Jourenkova N, Kataja V, et al. Glutathione S-transferase M1, M3, P1, and T1 genetic polymorphisms and susceptibility to breast cancer. Cancer Epidemiol Biomark Prev 2001;10:229–36.[Abstract/Free Full Text]
28. Kim SU, Lee KM, Park SK, et al. Genetic polymorphism of glutathione S-transferase P1 and breast cancer risk. J Biochem Mol Biol 2004;37:582–5.[Medline]
29. Kolm RH, Danielson UH, Zhang Y, Talalay P, Mannervik B. Isothiocyanates as substrates for human glutathione transferases: structure-activity studies. Biochem J 1995;311:453–9.[Medline]
30. Fowke JH, Shu XO, Dai Q, et al. Urinary isothiocyanate excretion, brassica consumption, and gene polymorphisms among women living in Shanghai, China. Cancer Epidemiol Biomark Prev 2003;12:1536–9.[Abstract/Free Full Text]
31. Ahn J, Gammon MD, Santella RM, et al. Effects of glutathione S-transferase A1 (GSTA1) genotype and potential modifiers on breast cancer risk. Carcinogenesis 2006;27:1876–82.[Abstract/Free Full Text]
32. Gao YT, Shu Xo, Dai Q, et al. Association of menstrual and reproductive factors with breast cancer risk: results from the Shanghai Breast Cancer Study. Int J Cancer 2000;87:295–300.[Medline]
33. Boyapati SM, Shu XO, Ruan ZX, et al. Soyfood intake and breast cancer survival: a followup of the Shanghai Breast Cancer Study. Breast Cancer Res Treat 2005;92:11–7.[Medline]
34. Cai Q, Shu XO, Wen W, et al. Functional Ser326Cys polymorphism in the hOGG1 gene is not associated with breast cancer risk. Cancer Epidemiol Biomark Prev 2006;15:403–4.[Free Full Text]
35. Shu XO, Yang G, Jin F, et al. Validity and reproducibility of the food frequency questionnaire used in the Shanghai Women's Health Study. Eur J Clin Nutr 2004;58:17–23.[Medline]
36. Jiao D, Yu MC, Hankin JH, Low SH, Chung FL. Total isothiocyanate contents in cooked vegetables frequently consumed in Singapore. J Agric Food Chem 1998;46:1055–8.
37. Wang LI, Giovannucci EL, Hunter D, Neuberg D, Su L, Christiani DC. Dietary intake of cruciferous vegetables, glutathione S-transferase (GST) polymorphisms and lung cancer risk in a Caucasian population. Cancer Causes Control 2004;15:977–85.[Medline]
38. Harries LW, Stubbins MJ, Forman D, Howard GC, Wolf CR. Identification of genetic polymorphisms at the glutathione S-transferase Pi locus and association with susceptibility to bladder, testicular and prostate cancer. Carcinogenesis 1997;18:641–4.[Abstract/Free Full Text]
39. Saarikoski ST, Voho A, Reinikainen M, et al. Combined effect of polymorphic GST genes on individual susceptibility to lung cancer. Int J Cancer 1998;77:516–21.[Medline]
40. Nijhoff WA, Mulder TPJ, Verhagen H, van Poppel G, Peter WHM. Effects of consumption of Brussels sprouts on plasma and urinary glutathione-S-transferase class - and - in humans. Carcinogenesis 1995;16:955–7.[Abstract/Free Full Text]
41. Seow A, Vainio H, Yu MC. Effect of glutathione-S-transferase polymorphisms on the cancer preventive potential of isothiocyanates: an epidemiological perspective. Mutat Res 2005;592:58–67.[Medline]
42. Getahun SM, Chung FL. Conversion of glucosinolates to isothiocyanates in humans after ingestion of cooked watercress. Cancer Epidemiol Biomark Prev 1999;8:447–51.[Abstract/Free Full Text]
43. Conaway CC, Getahun SM, Liebes LL, et al. Disposition of glucosinolates and sulforaphane in humans after ingestion of steamed and fresh broccoli. Nutr Cancer 2000;38:168–78.[Medline]

This article has been cited by other articles:

				P. Sun, J. Qian, Z.-b. Zhang, J.-x. Wan, F. Wu, X.-p. Jin, W.-w. Fan, D.-r. Lu, N.-q. Zhao, D. C. Christiani, et al. Polymorphisms in phase I and phase II metabolism genes and risk of chronic benzene poisoning in a Chinese occupational population Carcinogenesis, December 1, 2008; 29(12): 2325 - 2329. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) An erratum has been published Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lee, S.-A. Articles by Zheng, W. Search for Related Content PubMed PubMed Citation Articles by Lee, S.-A. Articles by Zheng, W. Agricola Articles by Lee, S.-A. Articles by Zheng, W.