|
|
||||||||
ORIGINAL RESEARCH COMMUNICATION |
1 From the National Center on Birth Defects and Developmental Disabilities (Q-HY and JDE), the National Center for Environmental Health (MG, DK, and SN), and the Coordinating Center for Health Promotion (KS), Centers for Disease Control and Prevention, Atlanta, GA; the Department of Pediatrics, University of Utah, Salt Lake City, UT (LDB); the Department of Medical Genetics, University of British Columbia, Vancouver, Canada (JMF); and the Harris Corporation/National Center of Health Statistics, Centers for Disease Control and Prevention, Hyattsville, MD (CLS)
2 The findings and conclusions in this report are those of the author(s) and do not necessarily represent the official position of the Centers for Disease Control and Prevention. 3 Partially funded by Seed Funding for Public Health Genomics Research, National Office of Public Health Genomics, Centers for Disease Control and Prevention. 4 Reprints not available. Address correspondence to Q-H Yang, National Office of Public Health Genomics, Centers for Disease Control and Prevention, 4770 Buford Highway, Mail stop K89, Atlanta, GA 30341. E-mail: qay0{at}cdc.gov.
| ABSTRACT |
|---|
|
|
|---|
Objective: The objective was to assess the prevalence of these genetic polymorphisms and their relation to serum folate and homocysteine concentrations.
Design: DNA samples from 6793 participants in the third National Health and Nutrition Examination Survey (NHANES III) during 1991–1994 were genotyped for polymorphisms of genes coding for folate pathway enzymes 5,10-methylenetetrahydrofolate reductase (MTHFR) 677C
T and 1298A
C, methionine synthase reductase (MTRR) 66A
G, and cystathionine-β-synthase 844ins68. The influence of these genetic variants on serum folate and homocysteine concentrations was analyzed by age, sex, and folate intake in 3 race-ethnicity groups.
Results: For all race-ethnicity groups, serum folate and homocysteine concentrations were significantly related to the MTHFR 677C
T genotype but not to the other polymorphisms. Persons with the MTHFR 677 TT genotype had a 22.1% (95% CI: 14.6%, 28.9%) lower serum folate and a 25.7% (95% CI: 18.6%, 33.2%) higher homocysteine concentration than did persons with the CC genotype. Moderate daily folic acid intake (mean: 150 µg/d; 95% CI: 138, 162) significantly reduced the difference in mean homocysteine concentrations between those with the MTHFR 677 CC and TT genotypes. We found a significant interaction between MTHFR 677C
T and MTRR 66A
G on serum homocysteine concentrations among non-Hispanic whites.
Conclusions: The MTHFR 677C
T polymorphism was associated with significant differences in serum folate and homocysteine concentrations in the US population before folic acid fortification. The effect of MTHFR 677C
T on homocysteine concentrations was reduced by moderate daily folic acid intake.
| INTRODUCTION |
|---|
|
|
|---|
There is continuing discussion about the relation between folic acid intake and the occurrence of dementia, cognitive function, osteoporosis, and several types of cancer (7-16). Many observational studies suggest that an elevated blood homocysteine concentration may be an independent risk factor for cardiovascular disease (CVD) and stroke (17-21), although clinical trials have not shown that a reduction in homocysteine concentrations with B vitamin supplementation has a major effect on the recurrence of CVD (22-24). These trials do provide some evidence that B vitamin supplementation may reduce the risk of stroke (23, 25-27), and we recently documented that the decline in annual stroke mortality that has been occurring for many years in the United States accelerated after the mandatory folic acid fortification of flour in 1998 (21).
Because of the clinical and public health importance of conditions that have been associated with low folic acid intake and elevated homocysteine concentrations, there is considerable interest in genetic factors involved in folate and homocysteine metabolism. Researchers have identified several common polymorphisms of genes that code for folate-metabolizing enzymes, including the 677C
T and the 1298A
C alleles of 5,10 methylenetetrahydrofolate reductase [MTHFR (MIM 607093)], the 66A
G allele of methionine synthase reductase [MTRR (MIM 602568)], and the 844ins68 allele of cystathionine-β-synthase [CBS (MIM 236200)]. Many of these polymorphisms are common, and their frequency varies by race-ethnicity (28-32). Several studies suggest that some of these genetic variants may influence folate metabolism and disease risk and that their effects vary among different populations, with some evidence of gene-gene and gene-nutrient interactions (28, 33-42).
Because of the frequency and potential role of these polymorphisms, the assessment of their prevalence and relation to serum folate and homocysteine concentrations is an important clinical and public health issue. To date, however, no study of these relations has been conducted in a large US population-based sample. We used genetic, serum, and survey data from the third National Health and Nutrition Examination Survey (NHANES III, 1988–1994), which includes a representative sample of the US population, to examine these relations in a representative sample of the US population. NHANES III measurements were taken in 1991–1994, before folic acid fortification, which has been mandated in the United States since 1998.
| SUBJECTS AND METHODS |
|---|
|
|
|---|
12 y. DNA lysates were created from cell lines generated using Epstein-Barr transformed lymphocytes from these blood specimens. The present study was approved by the Centers for Disease Control and Prevention (CDC)/National Center of Health Statistics Institutional Review Board.
Genotyping genetic variants related to folate metabolism
We genotyped selected polymorphisms of folate-metabolizing enzymes in DNA samples from 7159 individuals. The genes that we tested included 5,10-MTHFR (GenBank accession no. AY338232), CBS (GenBank accession no. L00972), and MTRR (GenBank accession no. AF025794). All gene names, gene symbols, and accession numbers are from GenBank (http://www.ncbi.nlm).
We genotyped MTHFR 1298A
C (rs1801131) by TaqMan (Applied Biosystems, Foster City, CA) using primers GGAGGAGCTGCTGAAGATGTG (forward) and TGGTTCTCCCGAGAGGTAAAGA (reverse), and fluorescently labeled probes 5VIC-ACCAGTGAAGAAAGTGT and 5FAM-CAGTGAAGCAAGTGT. The MTHFR 677C
T (rs1801133), MTRR 66A
G (rs1801394), and CBS 844ins68 insertion mutations were genotyped by using the MGB Eclipse Probe System [Nanogen (formerly Epoch Biosciences), Bothell, Washington]. The MTHFR 677C
T variant was genotyped by using the primers GGAAGAATGTGTCAGCCTCAAA (forward) and GACCTGAAGCACTTGAAGGAGA (reverse) and the fluorescently labeled probes 5 FAM-ATCGGCTCCCGC and 5 TET-AATCGACTCCCGC (Internet: http://snp500cancer.nci.nih.gov SNP500 assay number 002_0860). The MTRR 66A
G variant was genotyped by using the primers GCCTTGAAGTGATGAGGAGGTT (forward) and A*TCCA*TGTACCACAGCTTG (reverse) and the fluorescently labeled probes 5FAM- GAAGAAATATGTGA*G and 5TET-GAAGAAATGTG-TGAG. The CBS 844ins68 insertion polymorphism was genotyped by using the primers TTGTCTGCTCCGTCTGGTT (forward) and CTGGCCTTGAGCCCTGAA (reverse) and the fluorescently labeled probes 5FAM-GCTCCTCCGGCTC and 5TET-CA-CCTGGA*TGA*TC. Nucleotides marked with an asterisk indicate a modified base referred to as a Super A (Nanogen). All CBS heterozygote results were confirmed by conventional polymerase chain reaction (44). Stringent quality control was performed, which included blind replicate genotyping of 5% of the samples and used positive and negative controls on every plate.
Biochemical measures of serum folate and serum total homocysteine concentrations
Simultaneous serum folate/vitamin B-12 concentrations were determined by the National Center for Environmental Health/CDC using a commercially available radioprotein binding assay kit (Quantaphse II; Bio-Rad Laboratories, Hercules, CA) (45). Serum total homocysteine concentrations were measured at the Jean Mayer US Department of Agriculture Human Nutrition Research Center on Aging at Tufts University by the HPLC method of Araki and Sako (46) and Selhub et al (47).
Statistical analysis
We calculated sample-weighted allele frequencies, genotype prevalence, and their 95% CIs. To avoid nonresponse bias, the sample weights were recalculated by using previously described methods for the 7159 NHANES III participants for whom DNA was available (48).
We used chi-square statistics to test for differences in allele frequencies and genotype prevalence by race-ethnicity. We carried out Hardy-Weinberg equilibrium tests for each genetic variant by race-ethnicity.
NHANES III uses a complex sampling framework to ensure national representativeness. The NHANES III Analytic and Reporting Guidelines recommend assuming an average design effect of 1.3 and a minimum sample size of 39 (30 multiplied by the average design effect) (Internet: http://www.cdc.gov/nchs/data/nhanes/nhanes3/nh3gui.pdf) for reporting and comparing means. For most comparisons, our sample size was adequate (power > 80%;
= 0.05) to detect a difference in means of
20%.
Because the distributions of folate and homocysteine concentrations were positively skewed, logarithmic transformations of these data were performed before analysis. We used linear regression to estimate sample-weighted and adjusted geometric means and 95% CIs of folate and homocysteine concentrations by each genetic variant and by race-ethnicity (non-Hispanic white, non-Hispanic black, and Mexican American). For each marginal effects model, we adjusted for age, sex, smoking status (current smoking versus nonsmoking), estimated folic acid intake from dietary supplement use, food folate intake, and serum vitamin B-12. In NHANES III, the food folate intake (nutrient intake) data were derived from 1-d, in-person 24-h dietary recall interviews. We used Satterthwaite-adjusted statistics and their associated P values to test for significant differences in geometric means (49).
Effect modification
To examine pairwise gene-gene interactions on adjusted mean folate and homocysteine concentrations, we included an interaction term for one pair of genes at a time in the covariate-adjusted multiple regression models for each race-ethnicity (50). Because MTHFR 677C
T and 1298A
C are both polymorphisms of the same gene and are in strong linkage disequilibrium (Lewontin's D' = 0.9783, 0.8726, and 0.9432 for non-Hispanic whites, non-Hispanic blacks and Mexican Americans, respectively), no pairwise test for interaction was done between these 2 polymorphisms. However, we conducted stratified analysis between these 2 polymorphisms to examine their independent and joint effects on folate and homocysteine concentrations (Appendix A
). To account for multiple comparisons in searching for gene-gene interactions, the threshold for statistical significance was adjusted by controlling for the false discovery rates (FDR) (51), ie, we report FDR-adjusted P values that were calculated separately for each race-ethnicity group.
|
Folic acid intake is the most important determinant of serum folate and homocysteine concentrations (47). During the household interview in NHANES III, participants were asked about the use of dietary supplements during the previous month and how frequently any supplements were used. We calculated the daily folic acid intake for each supplement on the basis of folic acid content, the daily intake reported, and the frequency reported during the previous month. The daily intake for each product was then totaled for all products reported to yield the average daily folic acid intake from all supplements for each respondent. To examine the effect of folic acid intake on serum folate and homocysteine concentrations classified by genotypes, we classified the average daily intake of folic acid for all participants into 3 groups: supplement nonusers, supplement users with an average daily intake <400 µg, and supplement users with an average daily intake
400 µg (400 µg is the daily folic acid intake recommended for all women of childbearing age) (3). We stratified polymorphism genotype that had significant marginal effects by folic acid intake group and tested for significant differences in adjusted geometric mean serum folate and homocysteine concentrations within and across different intake groups. The threshold of significance was adjusted for FDR within each race-ethnicity group.
Because the dependency of homocysteine might shift from folate to vitamin B-12 with folic acid intervention, and this effect might be modulated by the MTHFR 677C
T genotype, we estimated the effect of serum folate and vitamin B-12 concentrations on homocysteine concentration stratified by supplement use. We also examined the effect of MTHFR 677C
T genotype on homocysteine concentration by quartiles of serum vitamin B-12 concentration, stratified by supplement use. For these analyses, we combined supplement users into 2 groups, ie, nonusers versus users and the 3 race-ethnicity groups into 1 group to increase the sample size.
To examine the effect of MTHFR 677C
T genotype or alcohol consumption on the inverse relation between folate intake and homocysteine concentration, we estimated total folate intake for each participant as food folate plus 1.7 times the amount of folic acid from supplement use (54) and calculated the quintiles of total folate intake. We classified subjects according to their average alcohol consumption during the past 12 mo into 4 groups: alcohol nonusers, <3 drinks/wk, 3–7 drinks/wk, and
7 drinks/wk. We examined the effect of MTHFR 677C
T genotype and alcohol consumption separately and jointly on the inverse relation between total folate intake and serum homocysteine concentration. For these analyses, we combined the 3 race-ethnicity groups together to increase the size of the subgroups.
We used SAS (version 9.1; SAS Institute Inc, Cary, NC) statistical software programs and SUDAAN (version 8.1) to account for the complex sampling design for our analyses (49).
| RESULTS |
|---|
|
|
|---|
T polymorphism for 7140 NHANES III respondents aged
12 y, MTHFR 1298A
C results for 7130 respondents, MTRR 66A
G results for 7132 respondents, and CBS 844ins68 results for 6971 respondents. We focused our analysis on 6793 subjects who had been typed for all 4 polymorphisms, including 2622 non-Hispanic white, 2103 non-Hispanic black, and 2068 Mexican American subjects. Individuals of other race-ethnicities were excluded because they were too few in number for statistical evaluation. All genotyping data used for this study were obtained from the NHANES genetic database.
Prevalence of genetic variants of folate-metabolizing enzymes
The prevalence of the variant T allele and of the homozygous TT genotype of the MTHFR 677C
T polymorphism among Mexican American subjects was significantly higher than among non-Hispanic white (P < 0.001) or non-Hispanic black (P < 0.0001) subjects (Table 1
). The prevalence of the variant alleles and homozygous variant genotypes for the MTHFR 1298A
C (Table 2
) and MTRR 66A
G (Table 3
) polymorphisms was significantly higher among non-Hispanic white subjects than among non-Hispanic black or Mexican American subjects (FDR-adjusted P < 0.001 for all comparisons). For CBS 844ins68 (Table 4
), non-Hispanic black subjects had a higher prevalence of the variant allele and homozygous variant genotype than did non-Hispanic white or Mexican American subjects (P < 0.0001 for all comparisons). All of these polymorphismswere in Hardy-Weinberg equilibrium within each race-ethnicity subgroup.
|
|
|
|
T genotype in all race-ethnicity groups (Table 5
|
T/1298A
C, which involve the same gene). We identified a statistically significant interaction involving MTHFR 677C
T and MTRR 66A
G on the average concentration of total plasma homocysteine among non-Hispanic white subjects (FDR-adjusted P = 0.0020) (Figure 1
|
|
|
T variant alleles
T genotype was seen among non-Hispanic white and Mexican American subjects who took
400 µg/d of supplemental folic acid (Table 6
400 µg/d) had significantly higher serum folate concentrations than did nonusers with the CC genotype (FDR-adjusted P = 0.0025). Among non-Hispanic black subjects, however, the presence of the MTHFR 677 TT genotype predicted a significantly lower folate concentration than did the CC genotype within each folic acid supplement user group.
|
T genotype on homocysteine concentration was seen among those who took folic acid supplements in any race-ethnicity group (Table 6
Because the relation between the MTHFR 677C
T variant and serum concentrations of folate and homocysteine was consistent across race-ethnicity, we combined all race-ethnicity groups to estimate the effect of folic acid use and MTHFR 677C
T genotype on folate and homocysteine concentrations, adjusted for race-ethnicity and other covariates. The serum folate concentration increased by 35.1% (95% CI: 21.5, 50.0) among those who consumed <400 µg/d folic acid and 91.0% (95% CI: 78.4, 104) among those who consumed
400 µg/d folic acid compared with nonusers (P < 0.0001). The difference between TT and CC genotypes decreased significantly as folic acid consumption increased and became nonsignificant among the group who took
400 µg/d (P = 0.3029).
Compared with nonusers of folic acid supplements, the homocysteine concentration decreased by 11.0% (95% CI: 7.5, 14.3) and 14.4% (95% CI: 12.4, 16.4), respectively, among those consuming <400 and
400 µg/d folic acid. The reduction in homocysteine concentration from <400 to
400 µg/d folic acid in users was not statistically significant (P = 0.0722).
Effect of interaction between MTHFR 677C
T, serum folate, and vitamin B-12 concentrations and folic acid supplement use
We observed independent and significant relations of serum folate and vitamin B-12 concentrations to serum homocysteine concentrations. This was seen among both folic acid supplement nonusers and users; the adjusted regression coefficient (β) ± SE = –0.250 ± 0.020 (P < 0.001) and –0.157 ± 0.027 (P < 0.001) for serum folate and vitamin B-12, respectively, among supplement nonusers and –0.171 ± 0.026 (P < 0.001) and –0.119 ± 0.049 (P < 0.001) among supplement users. Among supplement nonusers, the difference in homocysteine concentration between those with the lowest versus the highest quartiles of vitamin B-12 was 4.5 µmol/L (95% CI: 2.9, 6.4) in MTHFR 677C
T TT subjects, 1.2 µmol/L (95% CI: 0.8, 1.8) in CT subjects, and 1.2 µmol/L (95% CI: 1.0, 1.5) in CC subjects. Among supplement users, the corresponding values were 2.1 µmol/L (95% CI: 0.9, 5.2), 0.6 µmol/L (95% CI: 0.3, 1.3), and 1.0 µmol/L (95% CI: 0.6, 2.0), respectively.
Effect of MTHFR 677C
T genotype and alcohol consumption on folate intake and homocysteine concentration
We observed a significant inverse relation between total folate intake and serum homocysteine concentration. The adjusted geometric mean homocysteine concentration decreased from 9.7 µmol/L (95% CI: 9.3, 10.1) in the first quintile to 7.5 µmol/L (95% CI: 7.3, 7.8) in the highest quintile of total folate intake. This inverse relation was significantly modified by the MTHFR 677 C
T genotype (P = 0.0411 for interaction between MTHFR 677C
T genotype and quintiles of folate intake). The dose-response relation between folate intake and homocysteine was strongest among subjects with the MTHFR 677 TT genotype: homocysteine declined from 13.2 µmol/L (95% CI: 11.3, 15.4) in the lowest quintile to 8.2 µmol/L (95% CI: 7.5, 8.9) in the highest quintile, followed by subjects with the CT or CC genotype (Table 7
).
Alcohol consumption was significantly associated with serum homocysteine concentration. The geometric mean homocysteine concentration increased from 8.5 µmol/L (95% CI: 8.3, 8.7) among alcohol nonusers to 9.3 µmol/L (95% CI: 8.8, 9.8) among subjects who consumed
7 drinks/wk (P = 0.0028 for trend).However, there was no significant interaction between alcohol consumption and folate intake (P = 0.3397), and the decrease in serum homocysteine concentration from the lowest to the highest quintile of folate intake was not significantly different across the alcohol intake categories. The difference in homocysteine concentration between individuals in the lowest versus the highest quintiles of folate intake was 2.3 µmol/L (95% CI: 2.0, 2.6) among alcohol nonusers, 2.6 µmol/L (95% CI: 2.0, 3.3) among subjects who consumed <3 drinks/wk, 2.9 µmol/L (95% CI: 1.4, 4.5) among subjects who consumed 3–7 drinks/wk, and 1.8 µmol/L (95% CI: 0.9, 2.6) among subjects who consumed
7 drinks/wk (Table 7
).
|
T genotype and alcohol consumption (P = 0.6064 for the interaction between MTHFR 677C
T genotype and alcohol consumption and P = 0.2653 for the interaction between MTHFR 677C
T genotype, alcohol consumption, and quintile of folate intake) (Appendix D
|
| DISCUSSION |
|---|
|
|
|---|
T, MTHFR 1298A
C, MTRR 66A
G, and CBS 844ins68 gene variants differed significantly among race-ethnicity groups, which confirmed the findings of earlier studies (28-32, 55). Specifically, Mexican American subjects had the highest and non-Hispanic black subjects had the lowest frequency of the MTHFR 667T allele. Non-Hispanic white subjects had the highest frequencies of the MTHFR 1298C allele and the MTRR 66G allele (FDR-adjusted P < 0.0001). Non-Hispanic black subjects had a higher frequency of the homozygous CBS (84ins68) genotype than did the non-Hispanic white and Mexican American subjects (6.7% compared with <1%; FDR-adjusted P < 0.0001).
The NHANES III survey was designed to provide a nationally representative sample of the US population as a whole as well as of US non-Hispanic white, non-Hispanic black, and Mexican American subgroups (Internet: http://www.cdc.gov/nchs/about/major/nhanes/dnafnlgm2.htm#INTRODUCTION). In this representative sample, we found that among the gene variants studied, only the MTHFR 677C
T genotype had a significant marginal effect on adjusted serum folate and homocysteine concentrations across all race-ethnicity groups. These results are consistent with the findings of some previous studies (29, 37, 38, 55-57), but not others (34, 58-61). A number of studies suggest that the influence of the MTHFR 677C
T polymorphism on serum homocysteine concentration varies significantly among different populations (29, 57). For example, Gueant-Rodriguez et al (29) found that Mexicans from Mexico City had the highest allele frequency of the MTHFR 677C
T genotype and the least influence of the TT genotype on homocysteine concentrations. The opposite was observed among Africans, who had the lowest allele frequency and the greatest influence of the TT genotype on homocysteine concentration, although the number of Africans who had the TT genotype was small (n = 4 subjects). We also observed a high allele frequency among Mexican Americans and a low frequency among non-Hispanic blacks, but the influence of MTHFR 677C
T on homocysteine was significant among Mexican Americans and non-significant among non-Hispanic blacks.
Many studies have assessed pairwise interactions among various polymorphisms of folate-metabolizing enzymes (29, 35, 37, 60-64), but most investigators found no clear evidence of gene-gene interactions on serum folate or homocysteine concentrations. Vaughn et al (65) found that plasma homocysteine concentrations were significantly higher among women of childbearing age with a combined MTHFR 677 TT/MTRR 66 AG genotype than in all other combinations of MTHFR 677 CC or CT with MTRR 66A
G genotypes, but that study had limited power to detect differences between genotype groups. Our results suggest that there is a significant trend in serum total homocysteine concentration across the MTRR 66A
G genotypes among non-Hispanic white subjects who had an MTHFR 677 TT genotype.
The biochemistry of folate metabolism is highly complex (66, 67), and the mechanism responsible for the interaction we observed between the MTHFR 677 C
T and MTRR 66 A
G polymorphisms is not clear. Several studies suggest that the influence of the MTRR 66 A
G polymorphism on the enzyme activities may be mediated by other genetic variants in the folate metabolizing pathways (68, 69), some of which could not be evaluated in this study.
We are aware of no prior data on higher order interactions between multiple polymorphisms and serum folate and homocysteine concentrations. In this study, we did not find evidence of higher order interactions among polymorphisms of the 3 independent loci that we studied on serum folate or plasma homocysteine concentrations (Appendix C
).
Folic acid intake is the most important dietary determinant of serum folate and homocysteine concentrations (47, 70). A recent study indicated that the average serum folate concentration has more than doubled and that the red blood cell folate concentration has increased by
50% across race-ethnicity groups after folic acid fortification in the United States (71). Our results suggest that, before folic acid fortification, daily consumption of supplemental folic acid significantly increased serum folate concentration and decreased homocysteine concentrations regardless of MTHFR 677C
T genotype. The difference in serum folate or homocysteine concentrations by genotype decreased significantly as the folic acid dose increased, with the strongest reduction in subjects with the TT genotype compared with those with CC genotype of the MTHFR 677C
T variant.
Of note, a moderate average daily intake of supplemental folic acid (mean = 150 µg/d; 95% CI: 138, 162) appeared to counter the effect of the MTHFR 677 C
T variant on serum total homocysteine concentration, and this was seen in most race-ethnicity groups studied. No further reduction in serum total homocysteine concentration was seen with higher average daily folic acid intake (
400 µg/d). Previous studies indicate that folic acid intakes of 200 or 400 µg/d are associated with
60% or 90%, respectively, of the maximal reduction in homocysteine concentration that can be achieved with folic acid therapy (72). Our results suggest that even a lower daily dose of folic acid might significantly attenuate the effect of the MTHFR 677C
T polymorphism on homocysteine concentration.
Contrary to some previous findings (42), we observed a significant independent inverse relation between serum folate and vitamin B-12 concentrations and the serum homocysteine concentration among both supplement users and nonusers. Some studies suggest that the inverse relation between homocysteine and vitamin B-12 is modulated by MTHFR 677C
T polymorphism (73, 74). In our study, the positive association between MTHFR 677C
T polymorphism and higher homocysteine concentrations was modified by vitamin B-12, in that it was significantly stronger among subjects who did not use supplements and also had lower vitamin B-12 concentrations (<251 pmol/L) than did those who had higher B12 concentrations. Among supplement users, the effect of vitamin B-12 was less clear, and the relation between MTHFR 677C
T polymorphism and homocysteine concentration was significantly attenuated across all vitamin B-12 quartiles.
We found a significant modification of the inverse relation between folate intake and serum homocysteine concentration by the MTHFR 677C
T genotype—a finding that is consistent with other studies (36-40). We also observed a significant positive association between alcohol consumption and serum homocysteine concentration, as has been reported by others (41, 75-77). However, our results provide no evidence of a joint effect of MTHFR 677C
T and alcohol intake on the inverse relation between total folate intake and serum homocysteine concentration, as suggested by Chiuve et al (41).
To account for multiple comparisons, we adjusted the threshold of significance for P values in our study by FDR whenever applicable (51). Previous studies suggest that a conventional (unadjusted for multiple comparisons) threshold P value of < 0.01 is strongly predictive of future replication in genetic association studies (78, 79). Most of the FDR-adjusted P values < 0.05 in our study corresponded to conventional (unadjusted for multiple comparisons) P values
0.01.
In summary, our results suggest that dietary intake of folic acid can attenuate significantly the negative impact on serum folate and homocysteine of selected polymorphisms of folate-related genes. Folic acid fortification of flour in the United States has led to at least a doubling of serum folate concentrations throughout the population and to a dramatic decrease in the frequency of folate deficiency (70, 71). On the basis of our findings using prefortification NHANES III data, mandatory folic acid fortification of flour in the United States may have attenuated the effects of MTHFR 677C
T and the other polymorphisms we studied on serum folate and homocysteine concentrations. Additional studies are needed to determine whether this did, in fact, occur and whether it provides an additional benefit of fortification to individuals who are at increased risk of adverse health outcomes because of inherited variants of genes involved in folic acid metabolism.
| ACKNOWLEDGMENTS |
|---|
The authors' responsibilities were as follows—Q-HY: had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis; LDB, JDE, Q-HY, MG, and KS: study concept and design; Q-HY, JMF, LDB, MG, CLS, and KS: analysis and interpretation of the data; MG, DK, SN, and CLS: acquisition of data; Q-HY and JMF: drafting of the manuscript; Q-HY, LDB, MG, JMF, CLS, DK, SN, JDE, and KS: critical revision of the manuscript for important intellectual content; Q-HY, LDB, and JMF: statistical expertise; Q-HY, LDB, JDE, MG, CLS, DK, SN, and KS: administrative, technical, or material support; Q-HY, JMF, LDB, and KS: study supervision. None of the authors had a conflict of interest.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Q. Yang, R. M. Bostick, J.M. Friedman, and W. D. Flanders Serum Folate and Cancer Mortality Among U.S. Adults: Findings from the Third National Health and Nutritional Examination Survey Linked Mortality File Cancer Epidemiol. Biomarkers Prev., May 1, 2009; 18(5): 1439 - 1447. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Robitaille, H. C Hamner, M. E Cogswell, and Q. Yang Does the MTHFR 677C->T variant affect the Recommended Dietary Allowance for folate in the US population? Am. J. Clinical Nutrition, April 1, 2009; 89(4): 1269 - 1273. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Pullarkat, K. Danley, L. Bernstein, R. K. Brynes, and W. Cozen High Lifetime Incidence of Adult Acute Lymphoblastic Leukemia among Hispanics in California Cancer Epidemiol. Biomarkers Prev., February 1, 2009; 18(2): 611 - 615. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |