AJCN Cancer Health Disparities Conference
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Google Scholar
Right arrow Articles by Yang, Q.-H.
Right arrow Articles by Steinberg, K.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, Q.-H.
Right arrow Articles by Steinberg, K.
Agricola
Right arrow Articles by Yang, Q.-H.
Right arrow Articles by Steinberg, K.
American Journal of Clinical Nutrition, Vol. 88, No. 1, 232-246, July 2008
© 2008 American Society for Nutrition

ORIGINAL RESEARCH COMMUNICATION

Prevalence and effects of gene-gene and gene-nutrient interactions on serum folate and serum total homocysteine concentrations in the United States: findings from the third National Health and Nutrition Examination Survey DNA Bank1,2,3,4

Quan-He Yang, Lorenzo D Botto, Margaret Gallagher, JM Friedman, Christopher L Sanders, Deborah Koontz, Stanimila Nikolova, J David Erickson and Karen Steinberg

1 From the National Center on Birth Defects and Developmental Disabilities (Q-HY and JDE), the National Center for Environmental Health (MG, DK, and SN), and the Coordinating Center for Health Promotion (KS), Centers for Disease Control and Prevention, Atlanta, GA; the Department of Pediatrics, University of Utah, Salt Lake City, UT (LDB); the Department of Medical Genetics, University of British Columbia, Vancouver, Canada (JMF); and the Harris Corporation/National Center of Health Statistics, Centers for Disease Control and Prevention, Hyattsville, MD (CLS)

2 The findings and conclusions in this report are those of the author(s) and do not necessarily represent the official position of the Centers for Disease Control and Prevention.

3 Partially funded by Seed Funding for Public Health Genomics Research, National Office of Public Health Genomics, Centers for Disease Control and Prevention.

4 Reprints not available. Address correspondence to Q-H Yang, National Office of Public Health Genomics, Centers for Disease Control and Prevention, 4770 Buford Highway, Mail stop K89, Atlanta, GA 30341. E-mail: qay0{at}cdc.gov.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Background: Abnormalities of folate and homocysteine metabolism are associated with a number of pediatric and adult disorders. Folate intake and genetic polymorphisms encoding folate-metabolizing enzymes influence blood folate and homocysteine concentrations, but the effects and interactions of these factors have not been studied on a population-wide basis.

Objective: The objective was to assess the prevalence of these genetic polymorphisms and their relation to serum folate and homocysteine concentrations.

Design: DNA samples from 6793 participants in the third National Health and Nutrition Examination Survey (NHANES III) during 1991–1994 were genotyped for polymorphisms of genes coding for folate pathway enzymes 5,10-methylenetetrahydrofolate reductase (MTHFR) 677C->T and 1298A->C, methionine synthase reductase (MTRR) 66A->G, and cystathionine-β-synthase 844ins68. The influence of these genetic variants on serum folate and homocysteine concentrations was analyzed by age, sex, and folate intake in 3 race-ethnicity groups.

Results: For all race-ethnicity groups, serum folate and homocysteine concentrations were significantly related to the MTHFR 677C->T genotype but not to the other polymorphisms. Persons with the MTHFR 677 TT genotype had a 22.1% (95% CI: 14.6%, 28.9%) lower serum folate and a 25.7% (95% CI: 18.6%, 33.2%) higher homocysteine concentration than did persons with the CC genotype. Moderate daily folic acid intake (mean: 150 µg/d; 95% CI: 138, 162) significantly reduced the difference in mean homocysteine concentrations between those with the MTHFR 677 CC and TT genotypes. We found a significant interaction between MTHFR 677C->T and MTRR 66A->G on serum homocysteine concentrations among non-Hispanic whites.

Conclusions: The MTHFR 677C->T polymorphism was associated with significant differences in serum folate and homocysteine concentrations in the US population before folic acid fortification. The effect of MTHFR 677C->T on homocysteine concentrations was reduced by moderate daily folic acid intake.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Abnormalities in the metabolism of folate and homocysteine are associated with conditions that contribute significantly to morbidity and mortality among children and adults. For example, the use of dietary supplements containing folic acid reduces the risk of neural tube defects (NTDs) and possibly other congenital anomalies (1, 2) and is recommended for all women of childbearing age in the United States (3). Folic acid fortification of flour has led to a population-wide reduction in the occurrence of NTDs in the United States, Canada, and Chile (4-6), and this public health measure is now being considered in other countries.

There is continuing discussion about the relation between folic acid intake and the occurrence of dementia, cognitive function, osteoporosis, and several types of cancer (7-16). Many observational studies suggest that an elevated blood homocysteine concentration may be an independent risk factor for cardiovascular disease (CVD) and stroke (17-21), although clinical trials have not shown that a reduction in homocysteine concentrations with B vitamin supplementation has a major effect on the recurrence of CVD (22-24). These trials do provide some evidence that B vitamin supplementation may reduce the risk of stroke (23, 25-27), and we recently documented that the decline in annual stroke mortality that has been occurring for many years in the United States accelerated after the mandatory folic acid fortification of flour in 1998 (21).

Because of the clinical and public health importance of conditions that have been associated with low folic acid intake and elevated homocysteine concentrations, there is considerable interest in genetic factors involved in folate and homocysteine metabolism. Researchers have identified several common polymorphisms of genes that code for folate-metabolizing enzymes, including the 677C->T and the 1298A->C alleles of 5,10 methylenetetrahydrofolate reductase [MTHFR (MIM 607093)], the 66A->G allele of methionine synthase reductase [MTRR (MIM 602568)], and the 844ins68 allele of cystathionine-β-synthase [CBS (MIM 236200)]. Many of these polymorphisms are common, and their frequency varies by race-ethnicity (28-32). Several studies suggest that some of these genetic variants may influence folate metabolism and disease risk and that their effects vary among different populations, with some evidence of gene-gene and gene-nutrient interactions (28, 33-42).

Because of the frequency and potential role of these polymorphisms, the assessment of their prevalence and relation to serum folate and homocysteine concentrations is an important clinical and public health issue. To date, however, no study of these relations has been conducted in a large US population-based sample. We used genetic, serum, and survey data from the third National Health and Nutrition Examination Survey (NHANES III, 1988–1994), which includes a representative sample of the US population, to examine these relations in a representative sample of the US population. NHANES III measurements were taken in 1991–1994, before folic acid fortification, which has been mandated in the United States since 1998.


   SUBJECTS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Third National Health and Nutrition Examination Survey
The third National Health and Nutrition Examination Survey (NHANES III) used a stratified multistage probability design to obtain a nationally representative sample of the civilian, noninstitutionalized US population. In NHANES III, each survey participant was given a household interview and a physical examination (43). Blood specimens for DNA collection and analysis of biomarkers were obtained from NHANES III phase II (1991–1994) participants aged ≥12 y. DNA lysates were created from cell lines generated using Epstein-Barr transformed lymphocytes from these blood specimens. The present study was approved by the Centers for Disease Control and Prevention (CDC)/National Center of Health Statistics Institutional Review Board.

Genotyping genetic variants related to folate metabolism
We genotyped selected polymorphisms of folate-metabolizing enzymes in DNA samples from 7159 individuals. The genes that we tested included 5,10-MTHFR (GenBank accession no. AY338232), CBS (GenBank accession no. L00972), and MTRR (GenBank accession no. AF025794). All gene names, gene symbols, and accession numbers are from GenBank (http://www.ncbi.nlm).

We genotyped MTHFR 1298A->C (rs1801131) by TaqMan (Applied Biosystems, Foster City, CA) using primers GGAGGAGCTGCTGAAGATGTG (forward) and TGGTTCTCCCGAGAGGTAAAGA (reverse), and fluorescently labeled probes 5VIC-ACCAGTGAAGAAAGTGT and 5FAM-CAGTGAAGCAAGTGT. The MTHFR 677C->T (rs1801133), MTRR 66A->G (rs1801394), and CBS 844ins68 insertion mutations were genotyped by using the MGB Eclipse Probe System [Nanogen (formerly Epoch Biosciences), Bothell, Washington]. The MTHFR 677C->T variant was genotyped by using the primers GGAAGAATGTGTCAGCCTCAAA (forward) and GACCTGAAGCACTTGAAGGAGA (reverse) and the fluorescently labeled probes 5 FAM-ATCGGCTCCCGC and 5 TET-AATCGACTCCCGC (Internet: http://snp500cancer.nci.nih.gov SNP500 assay number 002_0860). The MTRR 66A->G variant was genotyped by using the primers GCCTTGAAGTGATGAGGAGGTT (forward) and A*TCCA*TGTACCACAGCTTG (reverse) and the fluorescently labeled probes 5FAM- GAAGAAATATGTGA*G and 5TET-GAAGAAATGTG-TGAG. The CBS 844ins68 insertion polymorphism was genotyped by using the primers TTGTCTGCTCCGTCTGGTT (forward) and CTGGCCTTGAGCCCTGAA (reverse) and the fluorescently labeled probes 5FAM-GCTCCTCCGGCTC and 5TET-CA-CCTGGA*TGA*TC. Nucleotides marked with an asterisk indicate a modified base referred to as a Super A (Nanogen). All CBS heterozygote results were confirmed by conventional polymerase chain reaction (44). Stringent quality control was performed, which included blind replicate genotyping of 5% of the samples and used positive and negative controls on every plate.

Biochemical measures of serum folate and serum total homocysteine concentrations
Simultaneous serum folate/vitamin B-12 concentrations were determined by the National Center for Environmental Health/CDC using a commercially available radioprotein binding assay kit (Quantaphse II; Bio-Rad Laboratories, Hercules, CA) (45). Serum total homocysteine concentrations were measured at the Jean Mayer US Department of Agriculture Human Nutrition Research Center on Aging at Tufts University by the HPLC method of Araki and Sako (46) and Selhub et al (47).

Statistical analysis
We calculated sample-weighted allele frequencies, genotype prevalence, and their 95% CIs. To avoid nonresponse bias, the sample weights were recalculated by using previously described methods for the 7159 NHANES III participants for whom DNA was available (48).

We used chi-square statistics to test for differences in allele frequencies and genotype prevalence by race-ethnicity. We carried out Hardy-Weinberg equilibrium tests for each genetic variant by race-ethnicity.

NHANES III uses a complex sampling framework to ensure national representativeness. The NHANES III Analytic and Reporting Guidelines recommend assuming an average design effect of 1.3 and a minimum sample size of 39 (30 multiplied by the average design effect) (Internet: http://www.cdc.gov/nchs/data/nhanes/nhanes3/nh3gui.pdf) for reporting and comparing means. For most comparisons, our sample size was adequate (power > 80%; {alpha} = 0.05) to detect a difference in means of ≥20%.

Because the distributions of folate and homocysteine concentrations were positively skewed, logarithmic transformations of these data were performed before analysis. We used linear regression to estimate sample-weighted and adjusted geometric means and 95% CIs of folate and homocysteine concentrations by each genetic variant and by race-ethnicity (non-Hispanic white, non-Hispanic black, and Mexican American). For each marginal effects model, we adjusted for age, sex, smoking status (current smoking versus nonsmoking), estimated folic acid intake from dietary supplement use, food folate intake, and serum vitamin B-12. In NHANES III, the food folate intake (nutrient intake) data were derived from 1-d, in-person 24-h dietary recall interviews. We used Satterthwaite-adjusted statistics and their associated P values to test for significant differences in geometric means (49).

Effect modification
To examine pairwise gene-gene interactions on adjusted mean folate and homocysteine concentrations, we included an interaction term for one pair of genes at a time in the covariate-adjusted multiple regression models for each race-ethnicity (50). Because MTHFR 677C->T and 1298A->C are both polymorphisms of the same gene and are in strong linkage disequilibrium (Lewontin's D' = 0.9783, 0.8726, and 0.9432 for non-Hispanic whites, non-Hispanic blacks and Mexican Americans, respectively), no pairwise test for interaction was done between these 2 polymorphisms. However, we conducted stratified analysis between these 2 polymorphisms to examine their independent and joint effects on folate and homocysteine concentrations (Appendix AGo). To account for multiple comparisons in searching for gene-gene interactions, the threshold for statistical significance was adjusted by controlling for the false discovery rates (FDR) (51), ie, we report FDR-adjusted P values that were calculated separately for each race-ethnicity group.


View this table:
[in this window]
[in a new window]

  		APPENDIX A Sample-weighted and adjusted geometric means ± SEs for serum folate and serum total homocysteine concentrations by combined 5,10-methylenetetrahydrofolate reductase (MTHFR) 677C->T and 1298A->C genotypes by race-ethnicity in the US population: data from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank1

 
Using a model-based approach to examine higher-order interactions produces groups that are too small to provide stable estimates for a considerable number of the strata in our sample (52). To examine interactions of the 4 polymorphisms simultaneously, we assumed a dominant effect of each genetic variant. Using dichotomous genotypes for the 4 polymorphisms, we divided the population into 16 strata, each with a different combination of presence or absence of the genetic variants (53). We calculated the prevalence of each 4-locus genotype and the adjusted geometric means of the folate and homocysteine concentrations for each stratum by race-ethnicity and tested for a significant difference in the concentration across the strata using the Satterthwaite method.

Folic acid intake is the most important determinant of serum folate and homocysteine concentrations (47). During the household interview in NHANES III, participants were asked about the use of dietary supplements during the previous month and how frequently any supplements were used. We calculated the daily folic acid intake for each supplement on the basis of folic acid content, the daily intake reported, and the frequency reported during the previous month. The daily intake for each product was then totaled for all products reported to yield the average daily folic acid intake from all supplements for each respondent. To examine the effect of folic acid intake on serum folate and homocysteine concentrations classified by genotypes, we classified the average daily intake of folic acid for all participants into 3 groups: supplement nonusers, supplement users with an average daily intake <400 µg, and supplement users with an average daily intake ≥400 µg (400 µg is the daily folic acid intake recommended for all women of childbearing age) (3). We stratified polymorphism genotype that had significant marginal effects by folic acid intake group and tested for significant differences in adjusted geometric mean serum folate and homocysteine concentrations within and across different intake groups. The threshold of significance was adjusted for FDR within each race-ethnicity group.

Because the dependency of homocysteine might shift from folate to vitamin B-12 with folic acid intervention, and this effect might be modulated by the MTHFR 677C->T genotype, we estimated the effect of serum folate and vitamin B-12 concentrations on homocysteine concentration stratified by supplement use. We also examined the effect of MTHFR 677C->T genotype on homocysteine concentration by quartiles of serum vitamin B-12 concentration, stratified by supplement use. For these analyses, we combined supplement users into 2 groups, ie, nonusers versus users and the 3 race-ethnicity groups into 1 group to increase the sample size.

To examine the effect of MTHFR 677C->T genotype or alcohol consumption on the inverse relation between folate intake and homocysteine concentration, we estimated total folate intake for each participant as food folate plus 1.7 times the amount of folic acid from supplement use (54) and calculated the quintiles of total folate intake. We classified subjects according to their average alcohol consumption during the past 12 mo into 4 groups: alcohol nonusers, <3 drinks/wk, 3–7 drinks/wk, and ≥7 drinks/wk. We examined the effect of MTHFR 677C->T genotype and alcohol consumption separately and jointly on the inverse relation between total folate intake and serum homocysteine concentration. For these analyses, we combined the 3 race-ethnicity groups together to increase the size of the subgroups.

We used SAS (version 9.1; SAS Institute Inc, Cary, NC) statistical software programs and SUDAAN (version 8.1) to account for the complex sampling design for our analyses (49).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
The National Center for Environmental Health/CDC generated genotype results for the MTHFR 677C->T polymorphism for 7140 NHANES III respondents aged ≥12 y, MTHFR 1298A->C results for 7130 respondents, MTRR 66A->G results for 7132 respondents, and CBS 844ins68 results for 6971 respondents. We focused our analysis on 6793 subjects who had been typed for all 4 polymorphisms, including 2622 non-Hispanic white, 2103 non-Hispanic black, and 2068 Mexican American subjects. Individuals of other race-ethnicities were excluded because they were too few in number for statistical evaluation. All genotyping data used for this study were obtained from the NHANES genetic database.

Prevalence of genetic variants of folate-metabolizing enzymes
The prevalence of the variant T allele and of the homozygous TT genotype of the MTHFR 677C->T polymorphism among Mexican American subjects was significantly higher than among non-Hispanic white (P < 0.001) or non-Hispanic black (P < 0.0001) subjects (Table 1Go). The prevalence of the variant alleles and homozygous variant genotypes for the MTHFR 1298A->C (Table 2Go) and MTRR 66A->G (Table 3Go) polymorphisms was significantly higher among non-Hispanic white subjects than among non-Hispanic black or Mexican American subjects (FDR-adjusted P < 0.001 for all comparisons). For CBS 844ins68 (Table 4Go), non-Hispanic black subjects had a higher prevalence of the variant allele and homozygous variant genotype than did non-Hispanic white or Mexican American subjects (P < 0.0001 for all comparisons). All of these polymorphismswere in Hardy-Weinberg equilibrium within each race-ethnicity subgroup.


View this table:
[in this window]
[in a new window]

  		TABLE 1 Sample-weighted allele and genotype frequencies and 95% CIs of 5,10 methylenetetrahydrofolate reductase (MTHFR) 677C->T by race-ethnicity in the US population: data from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank1

 

View this table:
[in this window]
[in a new window]

  		TABLE 2 Sample-weighted allele and genotype frequencies and 95% CIs of 5,10 methylenetetrahydrofolate reductase (MTHFR)1298A->C by race-ethnicity in the US population: data from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank1

 

View this table:
[in this window]
[in a new window]

  		TABLE 3 Sample-weighted allele and genotype frequencies and 95% CIs of methionine synthase reductase (MTRR) 66A->G by race-ethnicity in the US population: data from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank1

 

View this table:
[in this window]
[in a new window]

  		TABLE 4 Sample-weighted allele and genotype frequencies and 95% CIs of cystathionine-β-synthase (CBS) 844ins68 by race-ethnicity in the US population: data from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank1

 
Marginal effect of genetic variants of folate-metabolizing enzymes
We observed significant differences in the serum folate and homocysteine concentrations by MTHFR 677C->T genotype in all race-ethnicity groups (Table 5Go). The adjusted geometric mean serum folate concentration was 19.6% (95% CI: 12.5%, 26.2%), 33.6% (17.9%, 46.3%), and 21.3% (15.2%, 27.0%) lower among non-Hispanic white, non-Hispanic black, and Mexican American subjects, respectively, if they had the TT genotype than if they had the CC genotype. The adjusted geometric mean of serum total homocysteine concentration was 26.1% (17.6%, 35.2%), 39.7% (5.3%, 85.2%), and 21.4% (14.6%, 28.6%) higher among non-Hispanic white, non-Hispanic black, and Mexican American subjects, respectively, if they had the TT genotype than if they had the CC genotype. There was evidence of a dose-response relation between the CC, CT, and TT genotypes and serum folate and homocysteine concentrations in all race-ethnicity groups (Table 5Go). The other polymorphisms were not significantly associated with serum folate or homocysteine concentrations. The serum folate concentration appeared to be lower and the homocysteine concentration higher among homozygotes for CBS 844ins68 than among non-Hispanic whites with the wild type (Table 5Go), but the genotype frequency for homozygous CBS 844ins68 was very low among non-Hispanic whites (0.5%).


View this table:
[in this window]
[in a new window]

  		TABLE 5 Sample-weighted and adjusted geometric means (and 95% CIs) of serum folate and serum total homocysteine concentration by 5,10-methylenetetrahydrofolate reductase (MTHFR) 677C->T/1298A->C, methionine synthase reductase (MTRR) 66A->G, and cystathionine-β-synthase (CBS) 844ins68 genotypes and race-ethnicity in the US population: data from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank1

 
Pairwise tests for effect modification
Within each race-ethnicity group, we tested for the presence of interactions between pairs of polymorphic variants and average serum folate and homocysteine concentrations (except for MTHFR 677C->T/1298A->C, which involve the same gene). We identified a statistically significant interaction involving MTHFR 677C->T and MTRR 66A->G on the average concentration of total plasma homocysteine among non-Hispanic white subjects (FDR-adjusted P = 0.0020) (Figure 1Go). Individuals who were double homozygotes for the MTHFR 677 TT and MTRR 66 GG genotypes had a 25.6% (95% CI: 16.0, 34.4) lower serum total homocysteine concentration than did individuals who had TT/AA genotypes (P = 0.0138 for trend) (Appendix BGo).


Figure 1
View larger version (24K):
[in this window]
[in a new window]

  		FIGURE 1. Sample-weighted and adjusted geometric means for significant pairwise gene-gene interactions on serum total homocysteine concentrations among non-Hispanic white subjects. Data are from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank. The means were adjusted for age, sex, smoking status, estimated folic acid intake from dietary supplement use, food folate intake, and serum vitsmin B-12 concentration (pmol/L). P value for gene-gene interaction = 0.0020 based on a Satterthwaite-adjusted chi-square test and adjusted for multiple comparisons by calculating P values adjusted for false discovery rates. These adjusted P values were calculated separately for each race-ethnicity group. The P value for the trend (unadjusted P values) in homocysteine concentrations among individuals who were double homozygotes for the MTHFR 677 TT and across MTRR 66A->G genotypes was 0.0138 based on a Satterthwaite-adjusted chi-square test.

 

View this table:
[in this window]
[in a new window]

  		APPENDIX B Sample-weighted and adjusted geometric means (and 95% CIs) for joint distribution of significant pairwise gene-gene interactions, adjusted for false discovery rate (FDR), on serum total homocysteine concentrations among non-Hispanic white subjects: data from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank1

 
No significant differences in adjusted serum folate or homocysteine concentrations were found across different combinations of genetic variants in non-Hispanic white or non-Hispanic black subjects after adjustment for multiple comparisons (Appendix CGo). The statistically significant FDR-adjusted P value among Mexican American subjects for serum folate concentration across different combinations of genetic variants was dominated by the high frequency of the MTHFR T allele and the magnitude of the difference between the serum folate concentrations in individuals with TT or CT genotypes and those with a CC genotype (Table 5Go).


View this table:
[in this window]
[in a new window]

  		APPENDIX C Sample-weighted and adjusted geometric means (and 95% CIs) for serum folate and serum total homocysteine concentrations by combined 5,10-methylenetetrahydrofolate reductase (MTHFR) 677C->T/1298A->C, methionine synthase reductase (MTRR) 66A->G, and cystathionine-β-synthase (CBS) 844ins68 genetic variants (assuming dominant effect of genetic variants) and race-ethnicity in the US population: data from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank

 
Effect of folic acid intake on serum folate and homocysteine concentrations in subjects with MTHFR 677C->T variant alleles
Non-Hispanic white subjects with MTHFR 677 TT or CT genotypes, who took no folic acid supplements or took an average of <400 µg/d of supplemental folic acid, had lower mean serum folic acid concentrations than did subjects with CC genotypes who had similar folic acid supplement intakes (Table 6Go). In contrast, no significant effect of MTHFR 677 C->T genotype was seen among non-Hispanic white and Mexican American subjects who took ≥400 µg/d of supplemental folic acid (Table 6Go). Among non-Hispanic white and Mexican American subjects, those with the MTHFR 677 TT genotype who also had a high folic acid intake (≥400 µg/d) had significantly higher serum folate concentrations than did nonusers with the CC genotype (FDR-adjusted P = 0.0025). Among non-Hispanic black subjects, however, the presence of the MTHFR 677 TT genotype predicted a significantly lower folate concentration than did the CC genotype within each folic acid supplement user group.


View this table:
[in this window]
[in a new window]

  		TABLE 6 Sample-weighted and adjusted geometric means (and 95% CIs) of serum folate and serum total homocysteine concentrations by use of dietary supplements containing folic acid and 5,10-methylenetetrahydrofolate reductase (MTHFR) 677C->T genotype by race-ethnicity in the US population: data from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank1

 
Statistically significant differences in homocysteine concentrations by MTHFR 677 TT genotype were seen among nonusers of folic acid supplements in all race-ethnicity groups. Except for non-Hispanic blacks who took supplements at an average dose of <400 µg/d, no effect of the MTHFR 677 C->T genotype on homocysteine concentration was seen among those who took folic acid supplements in any race-ethnicity group (Table 6Go).

Because the relation between the MTHFR 677C->T variant and serum concentrations of folate and homocysteine was consistent across race-ethnicity, we combined all race-ethnicity groups to estimate the effect of folic acid use and MTHFR 677C->T genotype on folate and homocysteine concentrations, adjusted for race-ethnicity and other covariates. The serum folate concentration increased by 35.1% (95% CI: 21.5, 50.0) among those who consumed <400 µg/d folic acid and 91.0% (95% CI: 78.4, 104) among those who consumed ≥400 µg/d folic acid compared with nonusers (P < 0.0001). The difference between TT and CC genotypes decreased significantly as folic acid consumption increased and became nonsignificant among the group who took ≥ 400 µg/d (P = 0.3029).

Compared with nonusers of folic acid supplements, the homocysteine concentration decreased by 11.0% (95% CI: 7.5, 14.3) and 14.4% (95% CI: 12.4, 16.4), respectively, among those consuming <400 and ≥400 µg/d folic acid. The reduction in homocysteine concentration from <400 to ≥400 µg/d folic acid in users was not statistically significant (P = 0.0722).

Effect of interaction between MTHFR 677C->T, serum folate, and vitamin B-12 concentrations and folic acid supplement use
We observed independent and significant relations of serum folate and vitamin B-12 concentrations to serum homocysteine concentrations. This was seen among both folic acid supplement nonusers and users; the adjusted regression coefficient (β) ± SE = –0.250 ± 0.020 (P < 0.001) and –0.157 ± 0.027 (P < 0.001) for serum folate and vitamin B-12, respectively, among supplement nonusers and –0.171 ± 0.026 (P < 0.001) and –0.119 ± 0.049 (P < 0.001) among supplement users. Among supplement nonusers, the difference in homocysteine concentration between those with the lowest versus the highest quartiles of vitamin B-12 was 4.5 µmol/L (95% CI: 2.9, 6.4) in MTHFR 677C->T TT subjects, 1.2 µmol/L (95% CI: 0.8, 1.8) in CT subjects, and 1.2 µmol/L (95% CI: 1.0, 1.5) in CC subjects. Among supplement users, the corresponding values were 2.1 µmol/L (95% CI: 0.9, 5.2), 0.6 µmol/L (95% CI: 0.3, 1.3), and 1.0 µmol/L (95% CI: 0.6, 2.0), respectively.

Effect of MTHFR 677C->T genotype and alcohol consumption on folate intake and homocysteine concentration
We observed a significant inverse relation between total folate intake and serum homocysteine concentration. The adjusted geometric mean homocysteine concentration decreased from 9.7 µmol/L (95% CI: 9.3, 10.1) in the first quintile to 7.5 µmol/L (95% CI: 7.3, 7.8) in the highest quintile of total folate intake. This inverse relation was significantly modified by the MTHFR 677 C->T genotype (P = 0.0411 for interaction between MTHFR 677C->T genotype and quintiles of folate intake). The dose-response relation between folate intake and homocysteine was strongest among subjects with the MTHFR 677 TT genotype: homocysteine declined from 13.2 µmol/L (95% CI: 11.3, 15.4) in the lowest quintile to 8.2 µmol/L (95% CI: 7.5, 8.9) in the highest quintile, followed by subjects with the CT or CC genotype (Table 7Go).

Alcohol consumption was significantly associated with serum homocysteine concentration. The geometric mean homocysteine concentration increased from 8.5 µmol/L (95% CI: 8.3, 8.7) among alcohol nonusers to 9.3 µmol/L (95% CI: 8.8, 9.8) among subjects who consumed ≥7 drinks/wk (P = 0.0028 for trend).However, there was no significant interaction between alcohol consumption and folate intake (P = 0.3397), and the decrease in serum homocysteine concentration from the lowest to the highest quintile of folate intake was not significantly different across the alcohol intake categories. The difference in homocysteine concentration between individuals in the lowest versus the highest quintiles of folate intake was 2.3 µmol/L (95% CI: 2.0, 2.6) among alcohol nonusers, 2.6 µmol/L (95% CI: 2.0, 3.3) among subjects who consumed <3 drinks/wk, 2.9 µmol/L (95% CI: 1.4, 4.5) among subjects who consumed 3–7 drinks/wk, and 1.8 µmol/L (95% CI: 0.9, 2.6) among subjects who consumed ≥7 drinks/wk (Table 7Go).


View this table:
[in this window]
[in a new window]

  		TABLE 7 Sample-weighted and adjusted geometric means (and 95% CIs) of serum total homocysteine concentrations by 5,10-methylenetetrahydrofolate reductase (MTHFR) 677C->T genotype and alcohol consumption by quintiles of total folate intake in the US population: data from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank1

 
Similarly, the inverse relation between folate intake and homocysteine concentration did not appear to be modified by the joint effect of the MTHFR 677C->T genotype and alcohol consumption (P = 0.6064 for the interaction between MTHFR 677C->T genotype and alcohol consumption and P = 0.2653 for the interaction between MTHFR 677C->T genotype, alcohol consumption, and quintile of folate intake) (Appendix DGo).


View this table:
[in this window]
[in a new window]

  		APPENDIX D Sample-weighted and adjusted geometric means (and 95% CIs) of serum total homocysteine concentrations by alcohol consumption and 5,10-methylenetetrahydrofolate reductase (MTHFR) 677C->T genotype by quintiles of total folate intake in the US population: data from the third National Health and Nutrition Examination Survey (NHANES III) DNA Bank1

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this nationally representative sample of the US population (NHANES III), we evaluated the relation between variants of folate-related genes and serum folate and homocysteine concentrations and how these relations varied by intake of folic acid supplements, vitamin B-12 status, and alcohol intake. We found, first, that the frequencies of MTHFR 677C->T, MTHFR 1298A->C, MTRR 66A->G, and CBS 844ins68 gene variants differed significantly among race-ethnicity groups, which confirmed the findings of earlier studies (28-32, 55). Specifically, Mexican American subjects had the highest and non-Hispanic black subjects had the lowest frequency of the MTHFR 667T allele. Non-Hispanic white subjects had the highest frequencies of the MTHFR 1298C allele and the MTRR 66G allele (FDR-adjusted P < 0.0001). Non-Hispanic black subjects had a higher frequency of the homozygous CBS (84ins68) genotype than did the non-Hispanic white and Mexican American subjects (6.7% compared with <1%; FDR-adjusted P < 0.0001).

The NHANES III survey was designed to provide a nationally representative sample of the US population as a whole as well as of US non-Hispanic white, non-Hispanic black, and Mexican American subgroups (Internet: http://www.cdc.gov/nchs/about/major/nhanes/dnafnlgm2.htm#INTRODUCTION). In this representative sample, we found that among the gene variants studied, only the MTHFR 677C->T genotype had a significant marginal effect on adjusted serum folate and homocysteine concentrations across all race-ethnicity groups. These results are consistent with the findings of some previous studies (29, 37, 38, 55-57), but not others (34, 58-61). A number of studies suggest that the influence of the MTHFR 677C->T polymorphism on serum homocysteine concentration varies significantly among different populations (29, 57). For example, Gueant-Rodriguez et al (29) found that Mexicans from Mexico City had the highest allele frequency of the MTHFR 677C->T genotype and the least influence of the TT genotype on homocysteine concentrations. The opposite was observed among Africans, who had the lowest allele frequency and the greatest influence of the TT genotype on homocysteine concentration, although the number of Africans who had the TT genotype was small (n = 4 subjects). We also observed a high allele frequency among Mexican Americans and a low frequency among non-Hispanic blacks, but the influence of MTHFR 677C->T on homocysteine was significant among Mexican Americans and non-significant among non-Hispanic blacks.

Many studies have assessed pairwise interactions among various polymorphisms of folate-metabolizing enzymes (29, 35, 37, 60-64), but most investigators found no clear evidence of gene-gene interactions on serum folate or homocysteine concentrations. Vaughn et al (65) found that plasma homocysteine concentrations were significantly higher among women of childbearing age with a combined MTHFR 677 TT/MTRR 66 AG genotype than in all other combinations of MTHFR 677 CC or CT with MTRR 66A->G genotypes, but that study had limited power to detect differences between genotype groups. Our results suggest that there is a significant trend in serum total homocysteine concentration across the MTRR 66A->G genotypes among non-Hispanic white subjects who had an MTHFR 677 TT genotype.

The biochemistry of folate metabolism is highly complex (66, 67), and the mechanism responsible for the interaction we observed between the MTHFR 677 C->T and MTRR 66 A->G polymorphisms is not clear. Several studies suggest that the influence of the MTRR 66 A->G polymorphism on the enzyme activities may be mediated by other genetic variants in the folate metabolizing pathways (68, 69), some of which could not be evaluated in this study.

We are aware of no prior data on higher order interactions between multiple polymorphisms and serum folate and homocysteine concentrations. In this study, we did not find evidence of higher order interactions among polymorphisms of the 3 independent loci that we studied on serum folate or plasma homocysteine concentrations (Appendix CGo).

Folic acid intake is the most important dietary determinant of serum folate and homocysteine concentrations (47, 70). A recent study indicated that the average serum folate concentration has more than doubled and that the red blood cell folate concentration has increased by {approx}50% across race-ethnicity groups after folic acid fortification in the United States (71). Our results suggest that, before folic acid fortification, daily consumption of supplemental folic acid significantly increased serum folate concentration and decreased homocysteine concentrations regardless of MTHFR 677C->T genotype. The difference in serum folate or homocysteine concentrations by genotype decreased significantly as the folic acid dose increased, with the strongest reduction in subjects with the TT genotype compared with those with CC genotype of the MTHFR 677C->T variant.

Of note, a moderate average daily intake of supplemental folic acid (mean = 150 µg/d; 95% CI: 138, 162) appeared to counter the effect of the MTHFR 677 C->T variant on serum total homocysteine concentration, and this was seen in most race-ethnicity groups studied. No further reduction in serum total homocysteine concentration was seen with higher average daily folic acid intake (≥400 µg/d). Previous studies indicate that folic acid intakes of 200 or 400 µg/d are associated with {approx}60% or 90%, respectively, of the maximal reduction in homocysteine concentration that can be achieved with folic acid therapy (72). Our results suggest that even a lower daily dose of folic acid might significantly attenuate the effect of the MTHFR 677C->T polymorphism on homocysteine concentration.

Contrary to some previous findings (42), we observed a significant independent inverse relation between serum folate and vitamin B-12 concentrations and the serum homocysteine concentration among both supplement users and nonusers. Some studies suggest that the inverse relation between homocysteine and vitamin B-12 is modulated by MTHFR 677C->T polymorphism (73, 74). In our study, the positive association between MTHFR 677C->T polymorphism and higher homocysteine concentrations was modified by vitamin B-12, in that it was significantly stronger among subjects who did not use supplements and also had lower vitamin B-12 concentrations (<251 pmol/L) than did those who had higher B12 concentrations. Among supplement users, the effect of vitamin B-12 was less clear, and the relation between MTHFR 677C->T polymorphism and homocysteine concentration was significantly attenuated across all vitamin B-12 quartiles.

We found a significant modification of the inverse relation between folate intake and serum homocysteine concentration by the MTHFR 677C->T genotype—a finding that is consistent with other studies (36-40). We also observed a significant positive association between alcohol consumption and serum homocysteine concentration, as has been reported by others (41, 75-77). However, our results provide no evidence of a joint effect of MTHFR 677C->T and alcohol intake on the inverse relation between total folate intake and serum homocysteine concentration, as suggested by Chiuve et al (41).

To account for multiple comparisons, we adjusted the threshold of significance for P values in our study by FDR whenever applicable (51). Previous studies suggest that a conventional (unadjusted for multiple comparisons) threshold P value of < 0.01 is strongly predictive of future replication in genetic association studies (78, 79). Most of the FDR-adjusted P values < 0.05 in our study corresponded to conventional (unadjusted for multiple comparisons) P values ≤0.01.

In summary, our results suggest that dietary intake of folic acid can attenuate significantly the negative impact on serum folate and homocysteine of selected polymorphisms of folate-related genes. Folic acid fortification of flour in the United States has led to at least a doubling of serum folate concentrations throughout the population and to a dramatic decrease in the frequency of folate deficiency (70, 71). On the basis of our findings using prefortification NHANES III data, mandatory folic acid fortification of flour in the United States may have attenuated the effects of MTHFR 677C->T and the other polymorphisms we studied on serum folate and homocysteine concentrations. Additional studies are needed to determine whether this did, in fact, occur and whether it provides an additional benefit of fortification to individuals who are at increased risk of adverse health outcomes because of inherited variants of genes involved in folic acid metabolism.


   ACKNOWLEDGMENTS
 
We thank John Scott, Department of Clinical Medicine, Trinity College Dublin, Ireland; W Dana Flanders, Emory University Rollins School of Public Health; Muin Khoury, National Office of Public Health Genomics/CDC; Julie Robitaille, Department of Food Science and Nutrition, Laval University, Canada; and Lynn Bailey, Food Science and Human Nutrition Department, University of Florida, for their helpful comments. We also thank XianFen Li, National Center of Health Statistics/CDC, for help with the NHANES III data analysis.

The authors' responsibilities were as follows—Q-HY: had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis; LDB, JDE, Q-HY, MG, and KS: study concept and design; Q-HY, JMF, LDB, MG, CLS, and KS: analysis and interpretation of the data; MG, DK, SN, and CLS: acquisition of data; Q-HY and JMF: drafting of the manuscript; Q-HY, LDB, MG, JMF, CLS, DK, SN, JDE, and KS: critical revision of the manuscript for important intellectual content; Q-HY, LDB, and JMF: statistical expertise; Q-HY, LDB, JDE, MG, CLS, DK, SN, and KS: administrative, technical, or material support; Q-HY, JMF, LDB, and KS: study supervision. None of the authors had a conflict of interest.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. MRC Vitamin Study Research Group. Prevention of neural tube defects: results of the Medical Research Council Vitamin Study. Lancet 1991;338:131–7.[Medline]
  2. Botto LD, Olney RS, Erickson JD. Vitamin supplements and the risk for congenital anomalies other than neural tube defects. Am J Med Genet C Semin Med Genet 2004;125:12–21.
  3. Centers for Disease Control and Prevention. Recommendations for the use of folic acid to reduce the number of cases of spina bifida and other neural tube defects. MMWR Morb Mortal Wkly Rep 1992;41:1–7.[Medline]
  4. Honein MA, Paulozzi LJ, Mathews TJ, Erickson JD, Wong LY. Impact of folic acid fortification of the US food supply on the occurrence of neural tube defects. JAMA 2001;285:2981–6.[Abstract/Free Full Text]
  5. Mills JL, Signore C. Neural tube defect rates before and after food fortification with folic acid. Birth Defects Res A Clin Mol Teratol 2004;70:844–5.[Medline]
  6. Lopez-Camelo JS, Orioli IM, da Graca DM, et al. Reduction of birth prevalence rates of neural tube defects after folic acid fortification in Chile. Am J Med Genet A 2005;135:120–5.[Medline]
  7. Seshadri S, Beiser A, Selhub J, et al. Plasma homocysteine as a risk factor for dementia and Alzheimer's disease. N Engl J Med 2002;346:476–83.[Abstract/Free Full Text]
  8. Kim YI. Will mandatory folic acid fortification prevent or promote cancer? Am J Clin Nutr 2004;80:1123–8.[Abstract/Free Full Text]
  9. Sanjoaquin MA, Allen N, Couto E, Roddam AW, Key TJ. Folate intake and colorectal cancer risk: a meta-analytical approach. Int J Cancer 2005;113:825–8.[Medline]
  10. Ulrich CM, Potter JD. Folate supplementation: too much of a good thing? Cancer Epidemiol Biomarkers Prev 2006;15:189–93.[Free Full Text]
  11. McLean RR, Jacques PF, Selhub J, et al. Homocysteine as a predictive factor for hip fracture in older persons. N Engl J Med 2004;350:2042–9.[Abstract/Free Full Text]
  12. van Meurs JB, Dhonukshe-Rutten RA, Pluijm SM, et al. Homocysteine levels and the risk of osteoporotic fracture. N Engl J Med 2004;350:2033–41.[Abstract/Free Full Text]
  13. Eichholzer M, Tonz O, Zimmermann R. Folic acid: a public-health challenge. Lancet 2006;367:1352–61.[Medline]
  14. Cole BF, Baron JA, Sandler RS, et al. Folic acid for the prevention of colorectal adenomas: a randomized clinical trial. JAMA 2007;297:2351–9.[Abstract/Free Full Text]
  15. Balk EM, Raman G, Tatsioni A, Chung M, Lau J, Rosenberg IH. Vitamin B6, B12, and folic acid supplementation and cognitive function: a systematic review of randomized trials. Arch Intern Med 2007;167:21–30.[Abstract/Free Full Text]
  16. Smith AD, Kim YI, Refsum H. Is folic acid good for everyone? Am J Clin Nutr 2008;87:517–33.[Abstract/Free Full Text]
  17. Casas JP, Bautista LE, Smeeth L, Sharma P, Hingorani AD. Homocysteine and stroke: evidence on a causal link from Mendelian randomisation. Lancet 2005;365:224–32.[Medline]
  18. Homocysteine Studies Collaboration. Homocysteine and risk of ischemic heart disease and stroke: a meta-analysis. JAMA 2002;288:2015–22.[Abstract/Free Full Text]
  19. Wald DS, Law M, Morris JK. Homocysteine and cardiovascular disease: evidence on causality from a meta-analysis. BMJ 2002;325:1202.[Abstract/Free Full Text]
  20. Lewis SJ, Ebrahim S, Davey SG. Meta-analysis of MTHFR 677C->T polymorphism and coronary heart disease: does totality of evidence support causal role for homocysteine and preventive potential of folate? BMJ 2005;331:1053.[Abstract/Free Full Text]
  21. Yang Q, Botto LD, Erickson JD, et al. Improvement in stroke mortality in Canada and the United States, 1990 to 2002. Circulation 2006;113:1335–43.[Abstract/Free Full Text]
  22. Bonaa KH, Njolstad I, Ueland PM, et al. Homocysteine lowering and cardiovascular events after acute myocardial infarction. N Engl J Med 2006;354:1578–88.[Abstract/Free Full Text]
  23. Lonn E, Yusuf S, Arnold MJ, et al. Homocysteine lowering with folic acid and B vitamins in vascular disease. N Engl J Med 2006;354:1567–77.[Abstract/Free Full Text]
  24. Toole JF, Malinow MR, Chambless LE, et al. Lowering homocysteine in patients with ischemic stroke to prevent recurrent stroke, myocardial infarction, and death: the Vitamin Intervention for Stroke Prevention (VISP) randomized controlled trial. JAMA 2004;291:565–75.[Abstract/Free Full Text]
  25. Spence JD, Bang H, Chambless LE, Stampfer MJ. Vitamin Intervention For Stroke Prevention trial: an efficacy analysis. Stroke 2005;36:2404–9.[Abstract/Free Full Text]
  26. Wald DS, Wald NJ, Morris JK, Law M. Folic acid, homocysteine, and cardiovascular disease: judging causality in the face of inconclusive trial evidence. BMJ 2006;333:1114–7.[Free Full Text]
  27. Wang X, Qin X, Demirtas H, et al. Efficacy of folic acid supplementation in stroke prevention: a meta-analysis. Lancet 2007;369:1876–82.[Medline]
  28. Botto LD, Yang Q. 5,10-Methylenetetrahydrofolate reductase gene variants and congenital anomalies: a HuGE review. Am J Epidemiol 2000;151:862–77.[Abstract/Free Full Text]
  29. Gueant-Rodriguez RM, Gueant JL, Debard R, et al. Prevalence of methylenetetrahydrofolate reductase 677T and 1298C alleles and folate status: a comparative study in Mexican, West African, and European populations. Am J Clin Nutr 2006;83:701–7.[Abstract/Free Full Text]
  30. Wilcken B, Bamforth F, Li Z, et al. Geographical and ethnic variation of the 677C>T allele of 5,10 methylenetetrahydrofolate reductase (MTHFR): findings from over 7000 newborns from 16 areas world wide. J Med Genet 2003;40:619–25.[Free Full Text]
  31. Franco RF, Elion J, Lavinha J, Krishnamoorthy R, Tavella MH, Zago MA. Heterogeneous ethnic distribution of the 844ins68 in the cystathionine beta-synthase gene. Hum Hered 1998;48:338–42.[Medline]
  32. Vollset SE, Botto LD. Neural tube defects, other congenital malformations and single nucleotide polymorphisms in the 5,10 methylenetetrahydrofolate reductase (MTHFR) gene: a meta-analysis. In: Ueland PM, Rozen R, eds. MTHFR polymorphisms and disease. Georgetown, TX: Landes Bioscience, 2005.
  33. Ramsbottom D, Scott JM, Molloy A, et al. Are common mutations of cystathionine beta-synthase involved in the aetiology of neural tube defects? Clin Genet 1997;51:39–42.[Medline]
  34. Gaughan DJ, Kluijtmans LA, Barbaux S, et al. The methionine synthase reductase (MTRR) A66G polymorphism is a novel genetic determinant of plasma homocysteine concentrations. Atherosclerosis 2001;157:451–6.[Medline]
  35. Gueant-Rodriguez RM, Juilliere Y, Candito M, et al. Association of MTRRA66G polymorphism (but not of MTHFR C677T and A1298C, MTRA2756G, TCN C776G) with homocysteine and coronary artery disease in the French population. Thromb Haemost 2005;94:510–5.[Medline]
  36. de Bree A, Verschuren WM, Bjorke-Monsen AL, et al. Effect of the methylenetetrahydrofolate reductase 677C–>T mutation on the relations among folate intake and plasma folate and homocysteine concentrations in a general population sample. Am J Clin Nutr 2003;77:687–93.[Abstract/Free Full Text]
  37. Devlin AM, Clarke R, Birks J, Evans JG, Halsted CH. Interactions among polymorphisms in folate-metabolizing genes and serum total homocysteine concentrations in a healthy elderly population. Am J Clin Nutr 2006;83:708–13.[Abstract/Free Full Text]
  38. Jacques PF, Bostom AG, Williams RR, et al. Relation between folate status, a common mutation in methylenetetrahydrofolate reductase, and plasma homocysteine concentrations. Circulation 1996;93:7–9.[Abstract/Free Full Text]
  39. Russo GT, Friso S, Jacques PF, et al. Age and gender affect the relation between methylenetetrahydrofolate reductase C677T genotype and fasting plasma homocysteine concentrations in the Framingham Offspring Study Cohort. J Nutr 2003;133:3416–21.[Abstract/Free Full Text]
  40. Hustad S, Midttun O, Schneede J, Vollset SE, Grotmol T, Ueland PM. The methylenetetrahydrofolate reductase 677C-> T polymorphism as a modulator of a B vitamin network with major effects on homocysteine metabolism. Am J Hum Genet 2007;80:846–55.[Medline]
  41. Chiuve SE, Giovannucci EL, Hankinson SE, et al. Alcohol intake and methylenetetrahydrofolate reductase polymorphism modify the relation of folate intake to plasma homocysteine. Am J Clin Nutr 2005;82:155–62.[Abstract/Free Full Text]
  42. Quinlivan EP, McPartlin J, McNulty H, et al. Importance of both folic acid and vitamin B12 in reduction of risk of vascular disease. Lancet 2002;359:227–8.[Medline]
  43. Centers for Disease Control and Prevention. Plan and operation of the Third National Health and Nutrition Examination Survey, 1988–94. Series 1: programs and collection procedures. Vital Health Stat 1 1994;1–407.
  44. Tsai MY, Bignell M, Schwichtenberg K, Hanson NQ. High prevalence of a mutation in the cystathionine beta-synthase gene. Am J Hum Genet 1996;59:1262–7.[Medline]
  45. Raiten DJ, Fisher KD. Assessment of folate methodology used in the Third National Health and Nutrition Examination Survey (NHANES III, 1988–1994). J Nutr 1995;125(suppl):1371S–98S.[Medline]
  46. Araki A, Sako Y. Determination of free and total homocysteine in human plasma by high-performance liquid chromatography with fluorescence detection. J Chromatogr 1987;422:43–52.[Medline]
  47. Selhub J, Jacques PF, Rosenberg IH, et al. Serum total homocysteine concentrations in the third National Health and Nutrition Examination Survey (1991–1994): population reference ranges and contribution of vitamin status to high serum concentrations. Ann Intern Med 1999;131:331–9.[Abstract/Free Full Text]
  48. Lohr SL. Sampling: design and analysis. Pacific Grove, CA: Duxbury Press, 1999.
  49. Shah BV, Barnwell BG, Bieler GS. SUDAAN user's manual, release 8. Research Triangle Park, NC: Research Triangle Institute, 2000.
  50. Cordell HJ. Epistasis: what it means, what it doesn't mean, and statistical methods to detect it in humans. Hum Mol Genet 2002;11:2463–8.[Abstract/Free Full Text]
  51. Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc Ser B 1995;57:289–300.
  52. Luan JA, Wong MY, Day NE, Wareham NJ. Sample size determination for studies of gene-environment interaction. Int J Epidemiol 2001;30:1035–40.[Abstract/Free Full Text]
  53. Yang Q, Khoury MJ, Friedman J, Little J, Flanders WD. How many genes underlie the occurrence of common complex diseases in the population? Int J Epidemiol 2005;34:1129–37.[Abstract/Free Full Text]
  54. Suitor CW, Bailey LB. Dietary folate equivalents: interpretation and application. J Am Diet Assoc 2000;100:88–94.[Medline]
  55. Jacques PF, Bostom AG, Selhub J, et al. Effects of polymorphisms of methionine synthase and methionine synthase reductase on total plasma homocysteine in the NHLBI Family Heart Study. Atherosclerosis 2003;166:49–55.[Medline]
  56. Jacques PF, Kalmbach R, Bagley PJ, et al. The relationship between riboflavin and plasma total homocysteine in the Framingham Offspring cohort is influenced by folate status and the C677T transition in the methylenetetrahydrofolate reductase gene. J Nutr 2002;132:283–8.[Abstract/Free Full Text]
  57. Amouzou EK, Chabi NW, Adjalla CE, et al. High prevalence of hyperhomocysteinemia related to folate deficiency and the 677C–>T mutation of the gene encoding methylenetetrahydrofolate reductase in coastal West Africa. Am J Clin Nutr 2004;79:619–24.[Abstract/Free Full Text]
  58. Kluijtmans LAJ, Young IS, Boreham CA, et al. Genetic and nutritional factors contributing to hyperhomocysteinemia in young adults. Blood 2003;101:2483–8.[Abstract/Free Full Text]
  59. Martinez-Frias ML, Perez B, Desviat LR, et al. Maternal polymorphisms 677C-T and 1298A-C of MTHFR, and 66A-G MTRR genes: is there any relationship between polymorphisms of the folate pathway, maternal homocysteine levels, and the risk for having a child with Down syndrome? Am J Med Genet A 2006;140:987–97.[Medline]
  60. van der Put NM, Gabreels F, Stevens EM, et al. A second common mutation in the methylenetetrahydrofolate reductase gene: an additional risk factor for neural-tube defects? Am J Hum Genet 1998;62:1044–51.[Medline]
  61. Castro R, Rivera I, Ravasco P, et al. 5,10-Methylenetetrahydrofolate reductase 677C–>T and 1298A–>C mutations are genetic determinants of elevated homocysteine. QJM 2003;96:297–303.[Abstract/Free Full Text]
  62. Weisberg I, Tran P, Christensen B, Sibani S, Rozen R. A second genetic polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with decreased enzyme activity. Mol Genet Metab 1998;64:169–72.[Medline]
  63. Akar N, Akar E, Ozel D, Deda G, Sipahi T. Common mutations at the homocysteine metabolism pathway and pediatric stroke. Thromb Res 2001;102:115–20.[Medline]
  64. Lachmeijer AM, Arngrimsson R, Bastiaans EJ, et al. Mutations in the gene for methylenetetrahydrofolate reductase, homocysteine levels, and vitamin status in women with a history of preeclampsia. Am J Obstet Gynecol 2001;184:394–402.[Medline]
  65. Vaughn JD, Bailey LB, Shelnutt KP, et al. Methionine synthase reductase 66A->G polymorphism is associated with increased plasma homocysteine concentration when combined with the homozygous methylenetetrahydrofolate reductase 677C->T variant. J Nutr 2004;134:2985–90.[Abstract/Free Full Text]
  66. Nijhout HF, Reed MC, Budu P, Ulrich CM. A mathematical model of the folate cycle: new insights into folate homeostasis. J Biol Chem 2004;279:55008–16.[Abstract/Free Full Text]
  67. Reed MC, Nijhout HF, Neuhouser ML, et al. A mathematical model gives insights into nutritional and genetic aspects of folate-mediated one-carbon metabolism. J Nutr 2006;136:2653–61.[Abstract/Free Full Text]
  68. Gherasim C, Rosenblatt DS, Banerjee R. Polymorphic background of methionine synthase reductase modulates the phenotype of a disease-causing mutation. Hum Mutat 2007;28:1028–33.[Medline]
  69. Olteanu H, Wolthers KR, Munro AW, Scrutton NS, Banerjee R. Kinetic and thermodynamic characterization of the common polymorphic variants of human methionine synthase reductase. Biochemistry 2004;43:1988–97.[Medline]
  70. Pfeiffer CM, Caudill SP, Gunter EW, Osterloh J, Sampson EJ. Biochemical indicators of B vitamin status in the US population after folic acid fortification: results from the National Health and Nutrition Examination Survey 1999–2000. Am J Clin Nutr 2005;82:442–50.[Abstract/Free Full Text]
  71. Pfeiffer CM, Johnson CL, Jain RB, et al. Trends in blood folate and vitamin B-12 concentrations in the United States, 1988–2004. Am J Clin Nutr 2007;86:718–27.[Abstract/Free Full Text]
  72. Homocysteine Lowering Trialists' Collaboration. Dose-dependent effects of folic acid on blood concentrations of homocysteine: a meta-analysis of the randomized trials. Am J Clin Nutr 2005;82:806–12.[Abstract/Free Full Text]
  73. Bailey LB, Duhaney RL, Maneval DR, et al. Vitamin B-12 status is inversely associated with plasma homocysteine in young women with C677T and/or A1298C methylenetetrahydrofolate reductase polymorphisms. J Nutr 2002;132:1872–8.[Abstract/Free Full Text]
  74. Holm PI, Hustad S, Ueland PM, Vollset SE, Grotmol T, Schneede J. Modulation of the homocysteine-betaine relationship by methylenetetrahydrofolate reductase 677 C-> T genotypes and B-vitamin status in a large-scale epidemiological study. J Clin Endocrinol Metab 2007;92:1535–41.[Abstract/Free Full Text]
  75. Ganji V, Kafai MR. Demographic, health, lifestyle, and blood vitamin determinants of serum total homocysteine concentrations in the third National Health and Nutrition Examination Survey, 1988–1994. Am J Clin Nutr 2003;77:826–33.[Abstract/Free Full Text]
  76. Jacques PF, Bostom AG, Wilson PW, Rich S, Rosenberg IH, Selhub J. Determinants of plasma total homocysteine concentration in the Framingham Offspring cohort. Am J Clin Nutr 2001;73:613–21.[Abstract/Free Full Text]
  77. Sakuta H, Suzuki T. Alcohol consumption and plasma homocysteine. Alcohol 2005;37:73–7.[Medline]
  78. Hegele RA. SNP judgments and freedom of association. Arterioscler Thromb Vasc Biol 2002;22:1058–61.[Free Full Text]
  79. Lohmueller KE, Pearce CL, Pike M, Lander ES, Hirschhorn JN. Meta-analysis of genetic association studies supports a contribution of common variants to susceptibility to common disease. Nat Genet 2003;33:177–82.[Medline]
Received for publication November 10, 2007. Accepted for publication March 17, 2008.





This Article